Skip to main content

Advertisement

Table 4 Best primers and probes sequences for targetting the best genes unique to each species to give amplicon sizes approximately between 100 bp to 150 bp

From: Genome sequencing and comparison of five Tilletia species to identify candidate genes for the detection of regulated species infecting wheat

   Orthogroup putative function Effector analysisc    
Species Orthogroup ID InterProScana NCBI blastp nr databaseb Prediction Probability Forward Primer Probe Reverse Primer
Tilletia caries OG0010723 Unknown hypothetical protein Non-effector 0.71 TGTCTGCTACCTTTCTTTGGGTT CGGTCAGCATATCTAGCGTCGCAGCCT ACCTAGTTCGCAGGAAGAATGTT
OG0010724 Unknown GTPase Non-effector 0.69 TAGTGGATCGACAACGGAAAACT GTGATGTGGCGAAAACCATCGGGAGCC AGCTCATCAATCAGCTCGAACAG
OG0010727 Unknown hypothetical protein Non-effector 0.66 CTGAAATTGCTGTCATCTGGGTG ACCAGTCCTCGCCTACCTTGATAGCCA AACTAGACTCTGGTTAGACGTGC
OG0010729 Contains signal peptide hypothetical protein Effector 0.68 TTCTTATCTGCCCTTACCTGCTG TATCCACGTCACTCAAGCCTTGCGCCT CAGCCATAACAATCGCATACAGG
OG0010739 Contains DNA binding domain XRE family transcriptional regulator Non-effector 0.63 CCAAAGGCGATATGAGCGTCTC CCTGAAGCTGGTCAAGGCCGGACATCA CTCGTCGAGGATGTCTTCAATCG
OG0010773 Contains EamA domain EamA family transporter Non-effector 0.91 TCCAAATCCAGTAGCCAATGAGG TCGAGAAGATGGCGGCGTTGTCGATCT GGAGATTTATGTGCGGACATTGG
OG0010825 Unknown DUF2384 domain-containing protein Non-effector 0.59 GCTCAAAACGATACCAGGCATAG GCGGTTCCACCTTGCTGAGCACCTCTA CCGCATGGAATCAGATGACATTC
OG0010847 Unknown hypothetical protein Non-effector 0.81 CCTGTAGCAACTTCGTCAGATCC GTTCGCTGCCATCGACGAGCTGCTTTG AGCAGATCATCGTTCAGAACCTT
OG0010878 Contains domain associated eicosanoid/glutathione metabolism MAPEG family protein Non-effector 0.90 CAAGATCAACCAATGGACCTTGC GAGTGTCGGTGCTGGCAGTTTGATGGC GGTGAGAAAGAACTCCTCATGCT
OG0010879 Contains PDZ domain hypothetical protein Non-effector 0.54 TTCATCTTCAGGCTGACCAAAGT GCGCCACAGATCGCCGGAATTGTATGA GGAAGCGAGACGAGCAAATATTC
OG0010908 Contains signal peptide hypothetical protein Effector 0.65 TGAACCATCGGCTTTCTTAGTCA GCTCCCAACGACAGAAGCTGCTCCTCA GATGTCACTTGCTACGGCTACTA
OG0010935 Unknown hypothetical protein Unlikely effector 0.51 GACACTCGACCGCTATCTTCAAG CCGGAAAAGGGTGCCGTCACTCAGGAA CCGAAATCAATGCACGGTCATAT
OG0010940 Unknown hypothetical protein Effector 0.66 CGTAGAGTCGCCTCGAGAAATTA TCATGGGCCAATCCTCCAATGCGAACA GGAGCTTATCTGTAACCGCAAAA
OG0010947 Unknown hypothetical protein Unlikely effector 0.50 GATAGCCTTGATAATGCCGATGC GAGATCCGAGACTGCCCGGCTGACGTT TATAATCGACGATGAGCTACGGC
OG0011035 Unknown No significant hits found Non-effector 0.74 GATTCAAAATCGCGGGACAGTAC ATCAGGGCGAGCCTGTGATACACGGTG TCCAAAGATCAAGCTGGCGATTA
OG0011043 ABC-2 transporter ABC transporter permease Non-effector 0.89 CATCCATTGTTGATGCTGCTCTT CTGACGTCGATCACCTTCAGCCTCGCT CAGGCTCAATTGCTCGAAATTCT
OG0011044 Aspartic peptidase TIGR02281 family clan AA aspartic protease Unlikely effector 0.55 CCTGAGTTCATCCGTCTGCATC GCAGCGAACTCAGGCTCGACAAGAAGC GATCATGCGAACCAATGTCGAG
Tilletia controversa OG0009908 Unknown hypothetical protein Effector 0.69 CTTGACTCTCCAGTGGTCGAAG GGAACTCCCGTCAAGACAACAGCGACG TTCACGTACTACCTCAAGGACAG
Tilletia laevis OG0009501 Unknown hypothetical protein Effector 0.68 CGCAAACTGGAATGGACCATACT ATTCTACGCGCAACGGTCTGCAAGAGG GTTGTAAACTCGATCCGCATTCG
OG0009526 Unknown No significant hits found Non-effector 0.94 GTGAGGAATTACGATCTGTCCCC TACCCGATGAGATGCGTTCGGCTGGTC GATCCCACATACCAGAGTTCCAG
Tilletia indica OG0009272 Unknown hypothetical protein Non-effector 0.92 GAGGACCTTCAAGATCTGACAGG ACACCTAGGCCACTCCCTATCCAGCCA CTGATGATCTTGCCCGGTTTTAC
Tilletia walkeri OG0010415 Contains signal peptide hypothetical protein Unlikely effector 0.53 TCAACTACTTCGACTCCTCCTCC CTTCCGTGATCCCGTCAACGTCGGACT GCGACACCATCCTTAGTTGTGTA
OG0010423 Contains signal peptide hypothetical protein Non-effector 0.94 ATCTTCTACCCAATCACCTGCAG GCCCAGCAAGGTGTTTTTGGCCAAGGA ATAGCATCACTGATGAGCGTCTG
OG0010431 Contains signal peptide hypothetical protein Non-effector 0.52 TTTCGATCACAGGACCAAGGATC ACTTGAGGCCAGGGTGTCACATAGGCG GCACTTCTACCTTTCTACCCCTT
  1. aPutative function determined with Interproscan(https://www.ebi.ac.uk/interpro/search/sequence-search)
  2. bPutative function determined from NCBI’s blastp analyses on the nr database. Only results with alignment scores of > 80 were considered
  3. cEffector probability determined by effectorP 2.0 (http://effectorp.csiro.au)