Table 1 Primers used in this study for PCR and sequencing
Primer | Region | Application | Sequence | Reference |
|---|---|---|---|---|
ITS8F | nrITS | PCR and sequencing | AGTCGTAACAAGGTTTCCGTAGGTG | (Dentinger et al. 2010) |
ITS6R | nrITS | PCR and sequencing | TTCCCGCTTCACTCGCAGT | (Dentinger et al. 2010) |
LR0R | nrLSU | PCR and sequencing | ACCCGCTGAACTTAAGC | (Vilgalys and Hester 1990) |
LR7 | nrLSU | PCR and sequencing | TACTACCACCAAGATCT | (Vilgalys and Hester 1990) |
LR5 | nrLSU | Sequencing | TCCTGAGGGAAACTTCG | (Vilgalys and Hester 1990) |
fRPB2-5F | RPB2 | PCR and sequencing | GAYGAYMGWGATCAYTTYGG | (Liu et al. 1999) |
bRPB2–7.1R | RPB2 | PCR and sequencing | CCCATRGCYTGYTTMCCCATDGC | (Matheny 2005) |
bRPB2-6F | RPB2 | Sequencing | TGGGGYATGGTNTGYCCYGC | (Matheny 2005) |