Skip to main content

Table 1 Primers used in this study for PCR and sequencing

From: Reclassification of Pterulaceae Corner (Basidiomycota: Agaricales) introducing the ant-associated genus Myrmecopterula gen. nov., Phaeopterula Henn. and the corticioid Radulomycetaceae fam. nov.

Primer Region Application Sequence Reference
ITS8F nrITS PCR and sequencing AGTCGTAACAAGGTTTCCGTAGGTG (Dentinger et al. 2010)
ITS6R nrITS PCR and sequencing TTCCCGCTTCACTCGCAGT (Dentinger et al. 2010)
LR0R nrLSU PCR and sequencing ACCCGCTGAACTTAAGC (Vilgalys and Hester 1990)
LR7 nrLSU PCR and sequencing TACTACCACCAAGATCT (Vilgalys and Hester 1990)
LR5 nrLSU Sequencing TCCTGAGGGAAACTTCG (Vilgalys and Hester 1990)
fRPB2-5F RPB2 PCR and sequencing GAYGAYMGWGATCAYTTYGG (Liu et al. 1999)
bRPB2–7.1R RPB2 PCR and sequencing CCCATRGCYTGYTTMCCCATDGC (Matheny 2005)
bRPB2-6F RPB2 Sequencing TGGGGYATGGTNTGYCCYGC (Matheny 2005)