Skip to main content

Advertisement

Correction to: Proposal of a new nomenclature for introns in protein-coding genes in fungal mitogenomes

Correction to: IMA Fungus (2019) 10:15

https://doi.org/10.1186/s43008-019-0015-5

After publication of our article (Zhang and Zhang 2019) we have been notified us that the nad4L sequence should be corrected in Additional file 1. All sequences in the file should be that of NC_036382 (GenBank accession number), but have been erroneously pasted as the nad4L sequence of NC_001715.

  • Incorrect sequence:

">NAD4L_NC_001715

ATGCTTTTAGAAATAATAACAGCTTATAAAATAGGAACAATCTTATTTTTAATTGGAATTTTAGGTTTCATTATCAATAGACAAAATATTCTTTTACTTATTATCTCTATTGAAATGACTTTATTAGCTATTAGTTTTATTATTATTTGTTCTGCTCTTTTCCTTGATGATTCTGCAGCAGCTTGTTTTTCACTTTATATTTTAGCTCTTGCTGGTTCAGAAGCTGCAATTGGTCTTTCACTTTTAGTTTTATTCCATAGATTTAGAGGATCAGTATTAATTTCAGCTTCTCGACAATAG"

  • Correct sequence:

">nad4L_NC_036382

ATGAGTTTAACTTTAGTACTTTTTTTAATAGGAATCTTAGGATTCGTATTTAATAGAAAAAATATAATATTAATGCTTATTTCTATAGAAATAATGCTATTATCTATAACATTTTTAATATTGGTAAGTTCTATTAATCTTGACGATATAATAGGACAAACATATGCTATATACATTATAGTAGTTGCTGGTGCAGAATCTGCTATCGGTTTAGCTATTTTAGTAGCTTTTTATAGACTAAGAGGAAGTATCGCAATAGAATATAAATAA"

To be in concordance to this change, in Table 3, “P263” in the nad4L column should be changed to “P239”.

The authors would like to apologise for any inconvenience caused.

Reference

  1. Zhang, Zhang (2019) Proposal of a new nomenclature for introns in protein-coding genes in fungal mitogenomes. IMA Fungus 10:15. https://doi.org/10.1186/s43008-019-0015-5

Download references

Author information

Correspondence to Yong-Jie Zhang.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Zhang, S., Zhang, Y. Correction to: Proposal of a new nomenclature for introns in protein-coding genes in fungal mitogenomes. IMA Fungus 11, 7 (2020). https://doi.org/10.1186/s43008-020-00030-2

Download citation