- Correction
- Open Access
- Published:
Correction to: Heterothallism and potential hybridization events inferred for twenty-two yellow morel species
IMA Fungus volume 13, Article number: 10 (2022)
The Original Article was published on 12 February 2020
Correction to: IMA Fungus (2020) 11:4 https://doi.org/10.1186/s43008-020-0027-1
Following the publication of the original article (Du et al. 2020), we were notified of two mistaken pairs of primer sequences in Table 2, as shown below.
Incorrect sequence:
Corrected sequence:
EMAT1–1L: TGAGTCCGTTATGATTCTGG
EMAT1–1R: GGACCATTCGCTTTCTCATA
EMAT1–2L: GATATGCTCACCAACCGTAA
EMAT1–2R: TACGATCGAATAATGGCTCC
The original article has been corrected.
Reference
Du X-H et al (2020) Heterothallism and potential hybridization events inferred for twenty-two yellow morel species. IMA Fungus 11:4. https://doi.org/10.1186/s43008-020-0027-1
Author information
Authors and Affiliations
Corresponding authors
Additional information
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Du, XH., Wu, D., Kang, H. et al. Correction to: Heterothallism and potential hybridization events inferred for twenty-two yellow morel species. IMA Fungus 13, 10 (2022). https://doi.org/10.1186/s43008-022-00096-0
Published:
DOI: https://doi.org/10.1186/s43008-022-00096-0