Skip to main content

Correction to: Heterothallism and potential hybridization events inferred for twenty-two yellow morel species

The Original Article was published on 12 February 2020

Correction to: IMA Fungus (2020) 11:4 https://doi.org/10.1186/s43008-020-0027-1

Following the publication of the original article (Du et al. 2020), we were notified of two mistaken pairs of primer sequences in Table 2, as shown below.

Incorrect sequence:

figure a

Corrected sequence:

EMAT1–1L: TGAGTCCGTTATGATTCTGG

EMAT1–1R: GGACCATTCGCTTTCTCATA

EMAT1–2L: GATATGCTCACCAACCGTAA

EMAT1–2R: TACGATCGAATAATGGCTCC

The original article has been corrected.

Reference

Download references

Author information

Authors and Affiliations

Authors

Corresponding authors

Correspondence to Xi-Hui Du or Heng Kang.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Du, XH., Wu, D., Kang, H. et al. Correction to: Heterothallism and potential hybridization events inferred for twenty-two yellow morel species. IMA Fungus 13, 10 (2022). https://doi.org/10.1186/s43008-022-00096-0

Download citation

  • Published:

  • DOI: https://doi.org/10.1186/s43008-022-00096-0