Skip to main content

Advertisement

We're creating a new version of this page. See preview

  • Article
  • Open Access

Ustilago species causing leaf-stripe smut revisited

IMA Fungus20189:901049

https://doi.org/10.5598/imafungus.2018.09.01.05

  • Received: 13 January 2018
  • Accepted: 12 March 2018
  • Published:

Abstract

Leaf-stripe smuts on grasses are a highly polyphyletic group within Ustilaginomycotina, occurring in three genera, Tilletia, Urocystis, and Ustilago. Currently more than 12 Ustilago species inciting stripe smuts are recognised. The majority belong to the Ustilago striiformis-complex, with about 30 different taxa described from 165 different plant species. This study aims to assess whether host distinct-lineages can be observed amongst the Ustilago leaf-stripe smuts using nine different loci on a representative set. Phylogenetic reconstructions supported the monophyly of the Ustilago striiformis-complex that causes leaf-stripe and the polyphyly of other leaf-stripe smuts within Ustilago. Furthermore, smut specimens from the same host genus generally clustered together in well-supported clades that often had available species names for these lineages. In addition to already-named lineages, three new lineages were observed, and described as new species on the basis of host specificity and molecular differences: namely Ustilago jagei sp. nov. on Agrostis stolonifera, U. kummeri sp. nov. on Bromus inermis, and U. neocopinata sp. nov. on Dactylis glomerata.

Key words

  • DNA-based taxonomy
  • host specificity
  • molecular species discrimination
  • multigene phylogeny
  • new taxa
  • species complex
  • Ustilaginaceae

Introduction

The term “stripe smut” is commonly used to refer to Ustilaginomycotina species that cause dark brown to black linear sori of varying length in the leaves of grasses (Poaceae). Black spore masses are released after the spores have matured beneath the epidermis in the mesophyll of the host leaves (Fischer 1953, Vánky 2012). The spore release process of sori is unknown, but may be facilitated either by the withering of dead epidermal cells or by enzymatic action, as in the white blister rusts (Heller & 2009). Of the smut genera that infect grasses, Ustilago is the most prevalent (Stoll et al. 2003, 2005, Vánky2012).

The term stripe smut does not reflect phylogenetic relatedness, as at least two other genera, Tilletia and Urocystis, contain species that manifest similar symptoms. The vast majority of leaf-stripe smuts belong to Ustilago, including U. agropyri, U. bahuichivoensis, U. bethelii, U. calamagrostidis, U. calcarea, U. davisii, U. deyeuxiicola, U. echinata, U. filiformis, U. phlei, U. scrobiculata, U. serpens s. lat., U. sporoboli-indici, U. striiformis s. lat., U. trebouxii, U. trichoneurana, and U. ulei (Vánky 2012). Of these species, U. striiformis s. lat., with the type species described on Holcus lanatus, is a complex occurring on 164 species of Poaceae representing 44 different genera (Achnatherum, Agropyron, Agrostis, Alopecurus, Ammophila, Anthoxanthum, Arctagrostis, Arrhenatherum, Avena, Beckmannia, Brachypodium, Briza, Bromus, Calamagrostis, Cleistogenes, Cynosurus, Dactylis, Danthonia, Deschampsia, Deyeuxia, Elymus, Festuca, Helictotrichon, Hierochloë, Holcus, Hordeum, Hystrix, Koeleria, Leymus, Lolium, Melica, Milium, Pennisetum, Phalaris, Phleum, Piptatherum, Poa, Polypogon, Puccinellia, Sesleria, Setaria, Sitanion, Trisetaria, and Trisetum). Based on host specificity and minor differences in spore size and surface ornamentation, approximately 30 different taxa have been described in the U. striiformis species complex on various host plants (Vánky 2012, Savchenko et al. 2014a). Ustilago serpens probably represents an overlooked species complex, occuring on five host genera: Agropyron, Brachypodium, Bromus, Elymus, and Leymus. Whether other species with large warts on their spores also belong to this complex, such as U. echinata and U. scrobiculata, is currently unclear.

Ustilago striiformis s. lat. on Alopecurus pratensis has often been the sole representative of this group in phylogenetic analyses (Stoll et al. 2005, Begerow et al. 2006, McTaggart et al. 2012a). Stoll et al. (2005) supported the recognition of U. calamagrostidis, a parasite of several species of Calamagrostis, as separate from U. striiformis. The morphological difference was mainly in spore size and ornamentation. Savchenko et al. (2014a) provided a more detailed analysis of the U. striifomis species complex using several host-fungus combinations and phylogenetic reconstructions based on the nrITS and partial LSU regions. However, while two additional species were proposed as distinct in the U. striiformis-complex, the phylogenetic resolution was too low to draw further conclusions regarding host specificity and potential species boundaries. To resolve undescribed lineages within this species complex, Savchenko et al. (2014a) suggested that several additional gene loci and host-fungus combinations should be included. However, in line with Vánky (2012), Savchenko et al. (2014a) suggested that it would be difficult to distinguish between these lineages based on morphological characters. DNA-based characteristics, such as diagnostic SNPs, along with host specificity might be a solution towards characterizing and describing previously-named and new species (Denchev et al. 2009, Piątek et al. 2013). The aim of this study was to use a multigene phylogeny to infer the phylogenetic differentiation in the leaf stripe smuts in the genus Ustilago, particularly those in the U. striiformis species complex.

Material and Methods

Plant and fungal material

Specimens used in the study are listed in Table 1. The names of the hosts and fungi was derived from the latest version of The International Plant Names Index (https://doi.org/www.ipni.org), Index Fungorum (https://doi.org/www.indexfungorum.org/) and Vánky (2012), and partly following a broad generic concept for Ustilago (Thines 2016). A majority of the samples were collected in Germany (about 76) and most collections were not older than 20 years. Samples are deposited in Herbarium Senckenbergianum Görlitz (GLM). All host identifications were confirmed by ITS sequences.
Table 1

Smut specimens used for phylogenetic analysis.

    

Collection details

     

gene loci

    

DNA-no.

Species

Host

Location

Date

Collector

Fungarium no.

ITS

atp2

ssc1

map

myosin

rpl4A

rpl3

sdh1

tif2

2354

Sporisorium aff. inopiatum (Langdonia)

Aristida adscensionis

Zambia

12 Apr. 2001

C., T. & K. Vánky

M-0215944

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

KY929824

KY929964

KY930127

474

Ustilago agrostidis-palustris

Agrostis cf. gigantea

Germany, Bavaria

22 Jun. 2012

J. Kruse

GLM-F105832

KY929551

KY930157

KY929994

KY929709

KY929639

KY929849

KY929779

KY929919

KY930082

1374

 

Agrostis gigantea

Switzerland

9 Jul. 2004

V. Kummer

GLM-F107425

KY929582

KY930188

KY930025

KY929729

KY929659

KY929869

KY929799

KY929939

KY930102

2395

 

Agrostis sp.

Germany, Lower Saxony

12 Jul. 2014

J. Kruse & H. Jage

GLM-F107439

KY929596

KY930202

KY930039

KY929739

KY929669

KY929879

KY929809

KY929949

KY930112

2287

Ustilago airae-caespitosae

Deschampsia caespitosa

Polen

13 Jul. 1994

H. Scholz

B 70 0014901

KY929526

KY930132

KY929969

KY929688

KY929618

KY929828

KY929758

KY929898

KY930061

2401

 

Deschampsia caespitosa

Austria, Upper Austria

15 Aug. 2014

J. Kruse

GLM-F107444

KY929601

KY930207

KY930044

KY929744

KY929674

KY929884

KY929814

KY929954

KY930117

2402

 

Deschampsia caespitosa

Austria, Upper Austria

15 Aug. 2014

J. Kruse

GLM-F107445

KY929602

KY930208

KY930045

KY929745

KY929675

KY929885

KY929815

KY929955

KY930118

477

Ustilago alopecurivora

Alopecurus pratensis

Germany, Hesse

22 May 2010

J. Kruse

GLM-F105834

KY929553

KY930159

KY929996

KY929711

KY929641

KY929851

KY929781

KY929921

KY930084

1376

 

Alopecurus pratensis

Germany, Saxony-Anhalt

20 May 2013

H. Jage

GLM-F107426

KY929583

KY930189

KY930026

-

-

-

   

1822

Ustilago aff.

andropogonis (Sporisorium)

Bothriochloa ischaemum

Germany, Saxony-Anhalt

25 Jul. 2004

H. Jage & H. John

GLM-F062665

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

KY929764

KY929904

KY930067

432

Ustilago perennans

Arrhenatherum elatius

Germany, Schleswig-Holstein

21 Jun. 2007

J. Kruse

GLM-F105817

KY929536

KY930142

KY929979

KY929697

KY929627

KY929837

KY929767

KY929907

KY930070

2398

Ustilago brizae

Briza media

Austria, Tirol

21 Jul. 2014

J. Kruse

GLM-F107442

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

KY929812

KY929952

KY930115

  

Briza media

Germany, Bavaria

19 Jul. 2014

J. Kruse

GLM-F107443

KY929600

KY930206

KY930043

KY929743

KY929673

KY929883

KY929813

KY929953

KY930116

498

Ustilago bromina

Bromus inermis

Germany, Saxony-Anhalt

04 Jun. 2011

J. Kruse

GLM-F105843

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

KY929785

KY929925

KY930088

500

 

Bromus inermis

Germany, Thuringia

15 Jun. 2013

J. Kruse

GLM-F105844

KY929563

KY930169

KY930006

KY929716

KY929646

KY929856

KY929786

KY929926

KY930089

1180

 

Bromus inermis

Germany, Berlin

May 1983

H. Scholz

HUV No 498 (TUB)

KY929613

KY930219

KY930056

-

-

-

-

-

-

2070

 

Bromus inermis

Germany, Berlin

Aug. 1892

P. Sydow

B 70 0014775

KY929525

-

       

2275

 

Bromus inermis

Germany, Brandenburg

17 Jul. 2005

H. & I. Scholz

B 70 0014755

KY929524

KY930131

KY929968

-

-

-

-

-

-

2276

 

Bromus inermis

Germany, Thuringia

10 Sep. 1999

I. Scholz

B 70 0021843

KY929527

KY930133

KY929970

-

-

-

-

-

-

1591

Ustilago aff. bromivora

Bromus rigidus

Greece

23 Apr. 2013

C. & F. Klenke

GLM-F107429

KY929586

KY930192

KY930029

KY929731

KY929661

KY929871

KY929801

KY929941

KY930104

3370

 

Bromus sterilis

Spain, Andalusia

2 May 2015

J. Kruse

GLM-F107449

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

KY929818

KY929958

KY930121

442

Ustilago calamagrostidis

Calamagrostis epigejos

Germany, Lower Saxony

03 Aug. 2011

J. Kruse

GLM-F105818

KY929537

KY930143

KY929980

-

-

-

-

-

-

445

 

Calamagrostis epigejos

Germany, Baden-Württemberg

20 Jul. 2013

J. Kruse

GLM-F105819

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

KY929768

KY929908

KY930071

1383

 

Calamagrostis epigejos

Germany, Saxony-Anhalt

29 Jun. 2013

H.

Zimmermann, U. Richter

GLM-F107427

KY929584

KY930190

KY930027

KY929730

KY929660

KY929870

KY929800

KY929940

KY930103

1921

 

Calamagrostis epigejos

Germany, Saxony-Anhalt

09 Aug. 1996

H. Jage

GLM-F048100

KY929530

KY930136

KY929973

KY929691

KY929621

KY929831

KY929761

KY929901

KY930064

1182

Ustilago corcontica

Calamagrostis villosa

Germany, Saxony

22 Aug. 1987

W. Dietrich

HUV No 794 (TUB)

KY929615

KY930221

KY930058

-

-

-

-

-

-

1611

               
  

Calamagrostis villosa

Germany, Saxony-Anhalt

26 Jul. 2003

H. & U. Richter

GLM-F107434

KY929591

KY930197

KY930034

      

1825

Ustilago cruenta (Sporisorium)

Sorghum bicolor

Greece

11 May 2006

H-W, Otto

GLM-F078871

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

KY929766

KY929906

KY930069

3375

Ustilago cynodontis

Cynodon dactylon

Spain, Andalusia

3 May 2015

J. Kruse

GLM-F107450

KY929607

KY930213

KY930050

KY929749

KY929679

KY929889

KY929819

KY929959

KY930122

3376

 

Cynodon dactylon

Spain, Andalusia

3 May 2015

J. Kruse

GLM-F107451

KY929608

KY930214

KY930051

KY929750

KY929680

KY929890

KY929820

KY929960

KY930123

 

Ustilago aff dactyloctaenii (Sporisorium)

Dactyloctenium australe

South-Africa

22 Feb. 2000

V. Kummer

GLM-F107430

KY929587

KY930193

KY930030

KY929732

KY929662

KY929872

KY929802

KY929942

KY930105

478

Ustilago denotarisii

Arrhenatherum elatius

Germany, Schleswig-Holstein

13 May 2007

J. Kruse

GLM-F105835

KY929554

KY930160

KY929997

-

-

-

-

-

-

481

 

Arrhenatherum elatius

Germany,

Rhineland- Palatinate

23 May 2010

J. Kruse

GLM-F105836

KY929555

KY930161

KY929998

-

-

-

   

483

 

Arrhenatherum elatius

Germany, Lower Saxony

31 Jul. 2011

J. Kruse

GLM-F105837

KY929556

KY930162

KY929999

-

-

-

-

-

-

486

 

Arrhenatherum elatius

Germany, Thuringia

04 Jun. 2012

J. Kruse

GLM-F105838

KY929557

KY930163

KY930000

-

-

-

-

  

488

 

Arrhenatherum elatius

Germany, Bavaria

16 May 2013

J. Kruse

GLM-F105839

KY929558

KY930164

KY930001

-

-

-

-

-

-

447

Ustilago echinata

Phalaris arundinacea

Germany, Lower Saxony

01 Jul. 2010

J. Kruse

GLM-F105820

KY929539

KY930145

KY929982

KY929699

KY929629

KY929839

KY929769

KY929909

KY930072

449

 

Phalaris arundinacea

Germany, Lower Saxony

29 Aug. 2011

J. Kruse

GLM-F105821

KY929540

KY930146

KY929983

KY929700

KY929630

KY929840

KY929770

KY929910

KY930073

1914

 

Phalaris arundinacea

Switzerland, St. Gallen

26 Jul. 2000

H. Jage

GLM-F048338

KY929531

KY930137

KY929974

KY929692

KY929622

KY929832

KY929762

KY929902

KY930065

451

Ustilago aff. filiformis

Glyceria fluitans

Germany, Lower Saxony

17 May 2007

J. Kruse

GLM-F105822

KY929541

KY930147

KY929984

KY929701

KY929631

KY929841

KY929771

KY929911

KY930074

454

 

Glyceria fluitans

Germany, Bavaria

24 Jun. 2012

J. Kruse

GLM-F105823

KY929542

KY930148

KY929985

KY929702

KY929632

KY929842

KY929772

KY929912

KY930075

455

 

Glyceria fluitans

Germany, Bavaria

10 May 2013

J. Kruse

GLM-F105824

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

KY929773

KY929913

KY930076

456

Ustilago filiformis

Glyceria maxima

Germany, Lower Saxony

01 Jul. 2010

J. Kruse

GLM-F105825

KY929544

KY930150

KY929987

KY929704

KY929634

KY929844

KY929774

KY929914

KY930077

472

Ustilago jagei sp. nov.

Agrostis rupestris

Switzerland, Grisons

02 Aug. 2009

J. Kruse

GLM-F105830

KY929549

KY930155

KY929992

-

-

-

-

-

-

473

 

Agrostis stolonifera

Germany, Bavaria

20 May 2012

J. Kruse

GLM-F105831

KY929550

KY930156

KY929993

-

-

-

   

476

 

Agrostis stolonifera

Germany, Hesse

22 May 2010

J. Kruse

GLM-F105833

KY929552

KY930158

KY929995

KY929710

KY929640

KY929850

KY929780

KY929920

KY930083

551

 

Agrostis sp.

Germany, Lower Saxony

11 Jun. 2010

J. Kruse

GLM-F107423

KY929580

KY930186

KY930023

KY929727

KY929657

KY929867

KY929797

KY929937

KY930100

2396

 

Agrostis stolonifera

Germany, Bavaria

20 Jul. 2014

J. Kruse

GLM-F107440

KY929597

KY930203

KY930040

KY929740

KY929670

KY929880

KY929810

KY929950

KY930113

2397

 

Agrostis stolonifera

Germany, Hesse

27 Jun. 2014

J. Kruse

GLM-F107441

KY929598

KY930204

KY930041

KY929741

KY929671

KY929881

KY929811

KY929951

KY930114

494

 

Agrostis sp.

Germany, Bavaria

04 Jul. 2013

J. Kruse

GLM-F105841

KY929560

KY930166

KY930003

KY929713

KY929643

KY929853

KY929783

KY929923

KY930086

1375

 

Agrostis stolonifera

Germany, Saxony-Anhalt

16 Sep. 2001

H. Jage

GLM-F047379

KY929528

KY930134

KY929971

KY929689

KY929619

KY929829

KY929759

KY929899

KY930062

1612

Ustilago kummeri sp. nov.

Bromus inermis

Germany, Brandenburg

19 Jun. 2010

V. Kummer

GLM-F107435

KY929592

KY930198

KY930035

KY929736

KY929666

KY929876

KY929806

KY929946

KY930109

1948

 

Bromus inermis

Germany, Saxony-Anhalt

17 Jul. 2001

H. Jage, W. Lehman

GLM-F047380

KY929529

KY930135

KY929972

KY929690

KY929620

KY929830

KY929760

KY929900

KY930063

501

Ustilago loliicola

Lolium perenne

Germany, Bavaria

14 May 2013

J. Kruse

GLM-F105845

KY929564

KY930170

KY930007

-

-

-

-

-

-

2288A

 

Festuca pratensis

Germany, Hesse

25 May 2014

J. Kruse

GLM-F107437

KY929594

KY930200

KY930037

-

-

-

-

-

 

3386

 

Festuca arundinacea

Germany, Hesse

02 Nov. 2014

J. Kruse

GLM-F107454

KY929611

KY930217

KY930054

KY929753

KY929683

KY929893

KY929823

KY929963

KY930126

2815A

Ustilago maydis

Zea mays

Germany, Saxony-Anhalt

10 Jul. 2007

H. Jage

GLM-F107446

KY929603

KY930209

KY930046

KY929746

KY929676

KY929886

KY929816

KY929956

KY930119

1404

Ustilago milii

Milium effusum

Germany, Saxony-Anhalt

02 Jun. 2002

H. Jage

GLM-F107428

KY929585

KY930191

KY930028

-

-

-

-

-

-

2303

 

Milium effusum

Germany, Saxony

03 Jun. 2012

W. Dietrich

GLM-F107438

KY929595

KY930201

KY930038

KY929738

KY929668

KY929878

KY929808

KY929948

KY930111

3385

 

Milium effusum

Germany, Hesse

11 Jun. 2015

J. Kruse

GLM-F107453

KY929610

KY930216

KY930053

KY929752

KY929682

KY929892

KY929822

KY929962

KY930125

503

Ustilago neocopinata sp. nov.

Dactylis glomerata

Germany, Lower Saxony

01 Jul. 2010

J. Kruse

GLM-F105846

KY929565

KY930171

KY930008

-

-

-

-

-

-

505

 

Dactylis glomerata

Germany, Bavaria

20 Jun. 2010

J. Kruse

GLM-F105847

KY929566

KY930172

KY930009

-

-

-

-

-

-

506

 

Dactylis glomerata

Germany, Lower Saxony

19 May 2011

J. Kruse

GLM-F105848

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

KY929787

KY929927

KY930090

508

 

Dactylis glomerata

Germany, Bavaria

19 Jul. 2011

J. Kruse

GLM-F105849

KY929568

KY930174

KY930011

KY929718

KY929648

KY929858

KY929788

KY929928

KY930091

510

 

Dactylis glomerata

Germany, Bavaria

24 May 2012

J. Kruse

GLM-F105850

KY929569

KY930175

KY930012

KY929719

KY929649

KY929859

KY929789

KY929929

KY930092

512

 

Dactylis glomerata

Germany, Bavaria

15 Jun. 2012

J. Kruse

GLM-F107413

KY929570

KY930176

KY930013

-

-

-

-

-

-

521

 

Dactylis glomerata

Germany, Thuringia

15 Jun. 2013

J. Kruse

GLM-F107414

KY929571

KY930177

KY930014

-

-

-

-

  

463

Ustilago nuda

Hordeum vulgare

Germany, Bavaria

12 May 2012

J. Kruse

GLM-F105826

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

KY929775

KY929915

KY930078

884

Sporisorium aff. occidentale

Andropogon gerardii

USA

30 Jul. 1989

not known

HUV No 758 (TUB)

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

KY929825

KY929965

KY930128

471

Ustilago salweyi

Holcus mollis

Germany, Bavaria

11 Jun. 2012

J. Kruse

GLM-F105829

KY929548

KY930154

KY929991

KY929708

KY929638

KY929848

KY929778

KY929918

KY930081

489

 

Holcus mollis

Germany, Bavaria

16 May 2013

J. Kruse

GLM-F105840

KY929559

KY930165

KY930002

KY929712

KY929642

KY929852

KY929782

KY929922

KY930085

523

 

Holcus lanatus

Germany, Lower Saxony

24 May 2009

J. Kruse

GLM-F107415

KY929572

KY930178

KY930015

KY929720

KY929650

KY929860

KY929790

KY929930

KY930093

524

 

Holcus lanatus

Germany, Lower Saxony

22 May 2010

J. Kruse

GLM-F107416

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

KY929791

KY929931

KY930094

525

 

Holcus lanatus

Germany, Lower Saxony

27 May 2010

J. Kruse

GLM-F107417

KY929574

KY930180

KY930017

KY929722

KY929652

KY929862

KY929792

KY929932

KY930095

531

 

Holcus lanatus

Germany, Bavaria

17 May 2012

J. Kruse

GLM-F107418

KY929575

KY930181

KY930018

-

-

-

-

-

 

541

 

Holcus mollis

Germany, Saxony

03 Jun. 2011

J. Kruse

GLM-F107419

KY929576

KY930182

KY930019

KY929723

KY929653

KY929863

KY929793

KY929933

KY930096

543

 

Holcus mollis

Germany, Saxony-Anhalt

05 Jun. 2011

J. Kruse

GLM-F107420

KY929577

KY930183

KY930020

KY929724

KY929654

KY929864

KY929794

KY929934

KY930097

544

 

Holcus mollis

Germany, Saxony-Anhalt

05 Jun. 2011

J. Kruse

GLM-F107421

KY929578

KY930184

KY930021

KY929725

KY929655

KY929865

KY929795

KY929935

KY930098

545

 

Holcus mollis

Germany, Lower Saxony

17 Aug. 2011

J. Kruse

GLM-F107422

KY929579

KY930185

KY930022

KY929726

KY929656

KY929866

KY929796

KY929936

KY930099

497

Ustilago scaura

Helictotrichon pubescens

Germany, Rhineland-Palatinate

23 May 2010

J. Kruse

GLM-F105842

KY929561

KY930167

KY930004

KY929714

KY929644

KY929854

KY929784

KY929924

KY930087

3384

 

Helictotrichon pubescens

Germany, Hesse

10 Jun. 2015

J. Kruse

GLM-F107452

KY929609

KY930215

KY930052

KY929751

KY929681

KY929891

KY929821

KY929961

KY930124

1359

Ustilago aff.

schroeteriana (Sporisorium)

Paspalum virgatum

Costa Rica

15 Mar. 1991

T. & K. Vánky

HUV No 888 (TUB)

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

KY929826

KY929966

KY930129

1608

Ustilago scrobiculata

Calamagrostis epigejos

Germany, Brandenburg

17 Aug. 2011

V. Kummer & C. Buhr

GLM-F107431

KY929588

KY930194

KY930031

KY929733

KY929663

KY929873

KY929803

KY929943

KY930106

1609

 

Calamagrostis epigejos

Germany, Thuringia

27 May 2010

V. Kummer

GLM-F107432

KY929589

KY930195

KY930032

KY929734

KY929664

KY929874

KY929804

KY929944

KY930107

1610

 

Calamagrostis epigejos

Germany, Brandenburg

24 Jun. 2007

V. Kummer

GLM-F107433

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

KY929805

KY929945

KY930108

467

Ustilago serpens

Elymus repens

Germany, SchleswigHolstein

31 Jul. 2012

J. Kruse

GLM-F105827

KY929546

KY930152

KY929989

KY929706

KY929636

KY929846

KY929776

KY929916

KY930079

469

 

Elymus repens

Germany, Thuringia

15 Jun. 2013

J. Kruse

GLM-F105828

KY929547

KY930153

KY929990

KY929707

KY929637

KY929847

KY929777

KY929917

KY930080

3110

 

Elymus repens

Germany, Brandenburg

29 Jun. 2014

V. Kummer

GLM-F107447

KY929604

KY930210

KY930047

-

-

-

-

-

-

1305

Ustilago aff. sorghi (Sporisorium)

Sorghum plumosum

Australia

20 Feb. 1996

A. A. Mitchell, C. & K.Vánky

HUV No 970 (TUB)

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

KY929827

KY929967

KY930130

1951

Ustilago aff. syntherismae

Digitaria sanguinalis

Germany, Saxony-Anhalt

01 Oct. 2004

H. Jage

GLM-F064759

KY929534

KY930140

KY929977

KY929695

KY929625

KY929835

KY929765

KY929905

KY930068

1617

 

Digitaria sanguinalis

Germany, Brandenburg

11 Aug. 2001

V. Kummer

GLM-F107436

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

KY929807

KY929947

KY930110

553

Ustilago trichophora

Echinochloa crus-galli

Germany, North Rhine-Westphalia

04 Oct. 2010

J. Kruse

GLM-F107424

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

Kruse et al. 2017b

KY929798

KY929938

KY930101

1957

 

Echinochloa crus-galli

Germany, Saxony-Anhalt

01 Oct. 2003 H. Jage

GLM-F062638

KY929532

KY930138

KY929975

KY929693

KY929623

KY929833

KY929763

KY929903

KY930066

 

3347

Ustilago aff. vanderystii (Sporisorium)

Hyparrhenia hirta

Spain, Andalusia

22 Apr. 2015 J. Kruse

GLM-F107448

KY929605

KY930211

KY930048

KY929747

KY929677

KY929887

KY929817

KY929957

KY930120

 

Type specimens are printed in bold face.

DNA extraction and PCR

About 2–20 mg of infected plant tissue was taken from fungarium samples, placed in 2 mL plastic reaction tubes and homogenized in a mixer mill (MM2, Retsch) using a combination of three to five 1 mm and two 3 mm metal beads at 25 Hz for 5–10 min. Genomic DNA was extracted using the BioSprint 96 DNA Plant Kit (Qiagen, Hilden) loaded to a KingFisher Flex robot (Thermo Scientific, Dreieich).

The complete nrITS of all DNA extracts were amplified using PCR following the procedure of White et al. (1990). The primer pairs M-ITS1 (Stoll et al. 2003) / ITS4 (White et al. 1990) or M-ITS1 / smITS-R1 (Kruse et al. 2017a) were used as the reverse and forward primers, respectively. For DNA samples from historic specimens, including type specimens, the Ustilaginaceae-optimised reverse primer ITS-US3R (5‘TATCAAAACCCGGCAGGGAAG3’), located at the ITS2 region, was used.

The NL1 and NL4 primer pair (O’Donnell 1993) were used to amplify the Large Subunit (LSU) of the nrDNA with an annealing temperature of 53 °C. For other loci, the following regions were amplified with their respective primer pairs and annealing temperatures in brackets: myosin R0.5/F3 (55 °C), map R6/F2 (56 °C), rpl3 R1/F1 (53 °C), tif2 R3/F3 (53 °C), ssc1 R1/F2 (53 °C), sdh1 R3/F2 (53 °C), rpl4A R1/F4 (53 °C), and atp2 R4/F6 (53 °C) (Kruse et al. 2017b).

The plant ITS was amplified using the primer pair ITS1P and ITS4 (Ridgway et al. 2003) at 53 °C annealing temperature. The cycling reaction was performed in a thermocycler (Eppendorf Mastercycler 96 vapo protect; Eppendorf, Hamburg) with an initial denaturation at 95 °C for 4 min, 36 PCR cycles of denaturation at 95 °C for 40 s, annealing between 53–56 °C (depending on the specific primer pair) for 40 s and elongation at 72 °C for 60 s, followed by a final elongation at 72 °C for 4 min. For DNA samples older than 50 years, PCR cycles were increased to 46 cycles and a larger amount of DNA (1.5 µL of extracted DNA in a reaction volume of 11 µL) was used. The resulting amplicons were sequenced at the Biodiversity and Climate Research Centre (BiK-F) laboratory using the abovementioned PCR primers. However, amplicons from M-ITS1/smITS-R1 were sequenced using the ITS4 reverse primer. The resulting sequences were deposited in GenBank (https://doi.org/www.ncbi.nlm.nih.gov/genbank/, Table 1).

Alignments and phylogenetic tree reconstruction

We used 93 samples (including 62 of the Ustilago striiformis-complex) for the phylogenetic analysis; 93 had sequences from nrITS, atp2 (ATP synthase subunit 2) and ssc1 (member of the heat shock proteins), and 70 had additional sequences from myosin (myosin group I), map (methionine aminopeptidase), rpl3 (ribosomal protein L3), tif2 (initial translation factor of elF4A), sdh1 (succinate dehydrogenase ubiquinone flavoprotein), and rpl4A (ribosomal protein L4-A) (Table 1). About two thirds of the samples (62) belonged to the U. striiformis species complex. Sporisorium inopinatum (syn. Langdonia inopinata) was chosen as outgroup, according to the findings of McTaggart et al. (2012a).

Alignments were made on individual loci using mafft v. 7 (Katoh & Standley 2013) using the G-INS-i algorithm. Both leading and trailing gaps of the alignments were removed manually. Two different sets of concatenated alignments for the phylogenetic constructions were generated. The first multigene-alignment includes three loci (ITS, atp2, and ssc1) from 93 smut samples. The resulting total alignment was 1502 bp (ITS: 643 bp, atp2: 595 bp, ssc1: 264 bp). The second multigene-alignment included nine genes with a final alignment of 3156 bp (ITS: 643 bp, atp2: 595 bp, ssc1 264 bp, map: 251 bp, myosin: 257 bp, rpl4A: 415 bp, rpl3: 218 bp, sdh1: 269 bp, tif2: 244 bp).

The diagnostic bases for the U. striiformis species complex for all gene markers were determined using the above mentioned alignments. One further ITS alignment was created (443 bp), with the sequence of the type specimen of U. bromina (Table 1), the U. bromina sequences from GenBank (KF381006-8) and sequences from the same host-fungus-combination from this study, to check if all specimens were sequence-identical with the type collection of U. bromina on Bromus inermis (data not shown).

For phylogenetic tree constructions, Minimum Evolution (ME) analysis was done using Mega 6.06 (Tamura et al. 2013) with the Tamura-Nei substitution model and assuming complete deletion at 80 % cut-off with 1000 bootstrap replicates. All other parameters were set to default values. Maximum Likelihood (ML) analysis was done using RAxML (Stamatakis 2014) with parameters set to default values and Bayesian analysis was done using MrBayes 3.2 (Ronquist & Huelsenbeck 2003) running five times with model 6 (GTR) using four incrementally heated chains for 10 million generations, sampling every 1000th tree discarding the first 30 % of the obtained trees, all other parameters were set to default on the TrEase webserver (https://doi.org/www.thines-lab.senckenberg.de/trease).

To account for potentially deviating evolutionary properties, the analysis in ME was done also on a partitioned concatenated dataset. As no supported differences within the topology of the trees were observed in comparison with the un-partitioned dataset, the other analyses were carried out without partitioning.

Morphological examination

For light microscopy, fungarium specimens (GLM-F107417, GLM-F105836, GLM-F107435, GLM-F107413, GLM-F047379, GLM-F105827) were transferred to 60 % lactic acid on a slide. Morphological examination was carried out using a Zeiss Imager M2 AX10 microscope (Carl Zeiss, Göttingen). Measurements of the spores were performed at x400. The measurements are reported as maxima and minima in parentheses, and the mean plus and minus the standard deviation of a number of measurements is given in parenthesis. The means are placed in italics.

Results

Phylogenetic inference

The LSU sequence data were excluded from further analysis since sequences were identical for all members of the Ustilago striiformis species complex (data not shown). All other loci showed SNPs within the U. striiformis cluster. The diagnostic bases (SNPs) with their specific positions are given in Fig. 6.

There were no supported conflicts in the topology of the trees of the single loci and the concatenated trees. Thus, the datasets were combined and used as concatenated for further analysis. The multigene tree based on nine different loci (Fig. 1) showed strong to maximum support for a monophyly of the U. striiformis species complex. If multiple specimens from one host species were included, these grouped together with strong to maximum support, except for the clades corresponding to U. scaura s. lat. (ME 64, ML 63, BA 0.99), U. brizae (ME 63, ML 68, BA0.99), and U. agrostidis-palustris (ME 71, ML68, BA0.99), which received weak to strong support (Fig. 1).
Fig. 1
Fig. 1

Phylogenetic tree based on Minimum Evolution analysis of nine loci (ITS, myosin, map, rpl3, tif2, ssc1, sdh1, rpl4A, atp2). Numbers on branches denote support in Minimum Evolution, Maximum Likelihood and Bayesian Analyses, in the respective order. Values below 55 % are denoted by The bar indicates the number of substitutions per site.

A phylogenetic reconstruction (Fig. 2) with an additional 21 specimens but based on only half of the characters per specimen (ITS, atp2, and ssc1) revealed the same groups as the double-sized alignment, but expectedly with weaker statistical support. For example, the three weak to strongly supported lineages shown in Fig. 1 still grouped together, but with no or weak support (U. brizae — ME 64, ML -, BA 0.79; U. scaura s. lat. — ME -, ML -, BA 0.79; U. agrostidis-palustris- no support), highlighting the importance of gene selection.
Fig. 2
Fig. 2

Phylogenetic tree based on Minimum Evolution analysis of three loci (ITS, ssc1, atp2). Numbers on branches denote support in Minimum Evolution, Maximum Likelihood and Bayesian Analyses, in the respective order. Values below 55 % are denoted by ‘-’.. The bar indicates the number of substitutions per site.

In the phylogenetic reconstruction based on fewer genes (Fig. 2) additional specimens were included, which further supported the high degree of genetic differentiation in conjunction with the host species infected. Specimens from Festuca and Lolium grouped together with strong support, while the monophyly of the clade containing samples from Alopecurus species was unsupported to weakly supported (ME 64, ML -, BA -). Two monophyletic groups were absent from the tree with more loci (Fig. 1): one on Calamagrostis villosa and another on Arrhenatherum elatius. Both of these groups were highly supported (Calamagrostis: ME 76, ML 94, BA 0.99; Arrhenatherum: ME 92, ML 99, BA 1) in the tree based on fewer loci (Fig. 2).

In both phylogenetic trees (Figs 12), U. cynodontis was inferred as the sister species to the whole U. striiformis species complex. To illustrate the relationships within this species complex further, two additional phylogenetic trees with a reduced sampling and U. cynodontis as outgroup are shown in Figs 3 (9 loci) and 4 (3 loci). The support values and the topology were comparable to the phylogenetic reconstructions in Figs 12. In both phylogenetic trees, U. serpens on Elymus repens and on Bromus inermis grouped together with high to maximum support. This group clustered with two further lineages with larger echinulate spores compared to the U. striiformis species complex, which is considered a synapomorphy of this lineage.
Fig. 3
Fig. 3

Phylogenetic tree based on Minimum Evolution analysis of nine loci (ITS, myosin, map, rpl3, tif2, ssc1, sdh1, rpl4A, atp2) detailed showing the Ustilago striiformis-complex with the outgroup U. cynodontis. Numbers on branches denote support in Minimum Evolution, Maximum Likelihood and Bayesian Analyses, in the respective order. Values below 55 % are denoted by ‘-’. The bar indicates the number of substitutions per site.

Fig. 4
Fig. 4

Phylogenetic tree based on Minimum Evolution analysis of three loci (ITS, ssc1, atp2) detailed showing the Ustilago striiformis-complex with the outgroup U. cynodontis. Numbers on branches denote support in Minimum Evolution, Maximum Likelihood and Bayesian Analyses, in the respective order. Values below 55 % are denoted by ‘-’.. The bar indicates the number of substitutions per site.

The resolution on the backbone was rather low, as highlighted also by the ambiguous placement of U. maydis, which was resolved as a sister group to the pathogens on the majority of panicoid hosts in the tree based on 9 loci (Fig. 1) with moderate to maximum support, while being inferred as a sister to the clade containing the U. species complex as well as the U. nuda species group with lacking to maximum support in the tree based on three loci (Fig. 2).

Morphology

The degree of overlap in morphological characteristics was too high in both species complexes to provide easily accessible characteristics for species delimitation (Fig. 5). The individual measurements are included in the species descriptions below and summarized in Table 3.
Fig. 5
Fig. 5

Sori and spores of Ustilago jagei (A–B), U. denotarisii (C–D), U. neocopinata (E–F), U. salweyi (G–H), U. kummeri (I–J), and U. serpens s. str. (K–L). A. Sori of U. jagei on Agrostis stolonifera (GLM-F047379); B. Teliospores seen by LM; C. Sori of U. denotarisii on Arrhenatherum elatius (GLM-F105836); D. Teliospores seen by LM; E. Sori of U. neocopinata on Dactylis glomerata (GLM-F107413); F. Teliospores seen by LM; G. Sori of U. salweyi on Holcus lanatus (GLM-F107417); H. Teliospores seen by LM; I. Sori of U. kummeri on Bromus inermis (GLM- F107435); J. Teliospores seen by LM; K. Sori of U. serpens s. str. on Elymus repens (GLM-F105827); and L. Teliospores seen by LM.

Table 2

Diagnostic bases within the Ustilago striiformis and the Ustilago serpens complexes.

         

Gen Loci

        
 

atp 2

map

 

ssc 1

myosin

 

rpl 4A

 

rpl 3

 

sdh 1

 

tif2

ITS

U. striiformis-complex

Pos.

Base

Pos.

Base

Pos.

Base

Pos.

Base

Pos.

Base

Pos.

Base

Pos.

Base

Pos.

Base

Pos.

Base

on Agrostis gigantea

x

x

x

x

x

x

x

x

x

x

x

x

138

C / T

x

x

x

x

on Agrostis stolonifera and A. rupestris

                  

466

A / G

x

x

x

x

x

x

x

x

92

A / G

x

x

x

x

x

x

on Alopecurus pratensis

358

A / G

192

G / T

x

x

83

T / C

x

x

x

x

x

x

x

x

x

x

on Arrhenatherum elatius

346

A / G

x

x

182

A / C

x

x

x

x

x

x

x

x

 

x

x

x

on Bromus inermis

191, 244

G / A

x

x

232

C / T

x

x

228, 311 A / G 292 C / T

x

x

x

x

23

A / G

621

C / T

on Calamagrostis epigejos

91

A / G

x

x

x

x

x

x

x

  

x

x

x

65

T / C

102

T / C

on Calamagrostis villosa

535

T / C

x

x

x

x

x

x

x

x

x

x

x

x

x

x

x

x

on Dactylis glomerata

 

x

x

x

69, 198

A / G

x

x

120

T / C

40

A / G

x

x

x

x

617

A / G

on Deschampsia caespitosa

22, 94

A / G

227

T / C

x

x

133

A / G

x

x

199

T / C

x

x

x

x

576

A / G

on Festuca spp. and Lolium spp.

x

x

x

x

210, 214, 231 243

A / G T / C

x

x

x

x

x

x

x

x

x

x

x

A / G

on Holcus spp.

x

x

x

x

x

x

x

x

85

T / C

133

T / C

x

x

x

x

103

A / G

on Milium effusum

310

A/G

   

x

x

x

x

x

x

x

x

x

x

x

206

T / C

U. serpens-complex

Pos.

Base

Pos.

Base

Pos.

Base

Pos.

Base

Pos.

Base

Pos.

Base

Pos.

Base

Pos.

Base

Pos.

Base

on Bromus inermis

 

x

X

x

x

x

x

x

x

x

x

x

x

x

x

x

260 629

C / T G / A

 

175

G / A

92

A / C

88, 99

C / G

70

A / G

7

C / G

  

13

G / A

  

215

C / T

on Calamagrostis epigejos

181, 429, 496

T / C

203

C / T

93

G / A

225

T / C

91

T / C

28

G / T

25

G / T

xx

522

T / -

 

352

A / G

  

255

G / T

  

187

G / T

  

100

A / G

  

597 606

A / T A / G

on Elymus repens

x

x

x

x

x

x

93

A / G

232

T / C

x

x

x

x

x

x

157 170

A / G C / T

       

141

C / A

  

91

T / C

    

19

C / A

on Phalaris arundinacea

85

G / A

208

A / G

x

x

156

T / C

x

x

146

A / G

58, 256

A / G

x

x

38 186, 596

C / T A / -

                 

188, 604

G / A

Slash (/) = instead of, x = no diagnostic bases.

Table 3

Measurements from 100 teliospores for four different species of the Ustilago striiformis-complex on Agrostis stolonifera, Dactylis glomerata, Arrhenatherum elatius, and Holcus lanatus, as well as two species of the Ustilago serpens-complex on Elymus repens and Bromus inermis.

 

Ustilago striiformis-complex

Ustilago serpens-complex

 

U. jagei sp. nov.

U. denotarisii

 

U. neocopinata sp. nov.

U. salveii

 

U. serpens

 

U. kummeri sp. nov.

 

on Agrostis stolonifera

on Arrhenatherum elatius

on Dactylis glomerata

on Holcus lanatus

on Elymus repens

on Bromus inermis

  

spores

  

spores

  

spores

 

spores

 

spores

 

spores

 

No.

length

width

I/b

length

width

I/b

length

width

I/b

length

width

I/b

length

width

I/b

length

width

I/b

1

10.5

9.5

1.11

10

9

1.11

11

10.5

1.05

11.5

10.5

1.1

11

10.5

1.05

14

13

1.08

2

10

7.5

1.33

11.5

9

1.28

9.5

9.5

1

11.5

10

1.15

12

10

1.2

13.5

11

1.23

3

10.5

8.5

1.24

9

8

1.13

11

10

1.1

10

9.5

1.05

12.5

10

1.25

14.5

12

1.21

4

13.5

9.5

1.42

10

8

1.25

10.5

9.5

1.11

11

9.5

1.16

13

12

1.08

14

12.5

1.12

5

11

9

1.22

10.5

8.5

1.24

10.5

10

1.05

12

9.5

1.26

12.5

10.5

1.19

14

12

1.17

6

11

10

1.1

11.5

9

1.28

11

9.5

1.16

12

9

1.33

13

12.5

1.04

11.5

11.5

1

7

9.5

8

1.19

10.5

9.5

1.11

10

8.5

1.18

11

9

1.22

12.5

11.5

1.09

14

12

1.17

8

11

8

1.38

10.5

9.5

1.11

10.5

10

1.05

10.5

9

1.17

12.5

9.5

1.32

14

13.5

1.04

9

10.5

10

1.05

11.5

10

1.15

10.5

10

1.05

10

10

1

13.5

11

1.23

13

12.5

1.04

10

11.5

9

1.28

11.5

8.5

1.35

10.5

10.5

1

10.5

9.5

1.11

13

11

1.18

13.5

13.5

1

11

11.5

10

1.15

11

8

1.38

11

10

1.1

10.5

9.5

1.11

14.5

13.5

1.07

13.5

11.5

1.17

12

11.5

8

1.44

11

10

1.1

11

11

1

10.5

10

1.05

14.5

12

1.21

12.5

11

1.14

13

12

8

1.5

10.5

9

1.17

12

10.5

1.14

12.5

9

1.39

15.5

11

1.41

13.5

12.5

1.08

14

12

10.5

1.14

12

9

1.33

10

10

1

10

8

1.25

13

12.5

1.04

12

12

1

15

10

8.5

1.18

10.5

9

1.17

10.5

10.5

1

11

10

1.1

12.5

12

1.04

13.5

12.5

1.08

16

12

11.5

1.04

10.5

9.5

1.11

10.5

9.5

1.11

10.5

9.5

1.11

13

12.5

1.04

12

11.5

1.04

17

11

8

1.38

12

9

1.33

10

9

1.11

10

9

1.11

12

11.5

1.04

13.5

13

1.04

18

11

9.5

1.16

12.5

10.5

1.19

10

9.5

1.05

11.5

9.5

1.21

13

10.5

1.24

14.5

13

1.12

19

11

9

1.22

10

9

1.11

10.5

9.5

1.11

10

9

1.11

13

11.5

1.13

13

11.5

1.13

20

12

9.5

1.26

12.5

11

1.14

11

10.5

1.05

10.5

9.5

1.11

13

12

 

13.5

13

1.04

21

11

9.5

1.16

12.5

11.5

1.09

10.5

10

1.05

10.5

9

1.17

12.5

11

1.14

14.5

12

1.21

22

13

9.5

1.37

13.5

12

1.13

11.5

10.5

1.1

10

8.5

1.18

12

11.5

1.04

13.5

12.5

1.08

23

12.5

10

1.25

13.5

10

1.35

11

11

1

11.5

9

1.28

13

11.5

1.13

13

12.5

1.04

24

11.5

10

1.15

11.5

10.5

1.1

10

9.5

1.05

10

9.5

1.05

13.5

12

1.13

12.5

12

1.04

25

10.5

8.5

1.24

11.5

9.5

1.21

11

10.5

1.05

11

9.5

1.16

13

10.5

1.24

15

13.5

1.11

26

10.5

10

1.05

12.5

11

1.14

11

10.5

1.05

9.5

9

 

12

10.5

1.14

13

11.5

1.13

27

11

9

1.22

12.5

11.5

1.09

11

10

1.1

10.5

9

1.17

12.5

12

1.04

13.5

13.5

1

28

10.5

10.5

1

11

10.5

1.05

10.5

9

1.17

10

9.5

1.05

13

12

1.08

13.5

11.5

1.17

29

11

9.5

1.16

11

11

1

11

11

1

10

9

1.11

14

12.5

1.12

13.5

11.5

1.17

30

10.5

7.5

1.4

11

9.5

1.16

10

10

1

10

9

1.11

12

11

1.09

13

12.5

1.04

31

10.5

9

1.17

11

9

1.22

10

9.5

1.05

10

9

1.11

12.5

11.5

1.09

13

11

1.18

32

10

8.5

1.18

11.5

10.5

1.1

10

9.5

1.05

11

10

1.1

14.5

12.5

1.16

14

13

1.08

33

10.5

9.5

1.11

11

8.5

1.29

10.5

10.5

1

10

9

1.11

13

11.5

1.13

14

13

1.08

34

10.5

9.5

1.11

11.5

9

1.28

10.5

10.5

1

11

8.5

1.29

14

12.5

1.12

14

13

1.08

35

11.5

10

1.15

12.5

9.5

1.32

11

10

1.1

11

10

1.1

12

11.5

1.04

12.5

12

1.04

36

12

9

1.33

10.5

8.5

1.24

10.5

9.5

1.11

10

9

1.11

14.5

11.5

1.26

13

11

1.18

37

11

9.5

1.16

12.5

10.5

1.19

11

10.5

1.05

10

8.5

1.18

12.5

11.5

1.09

15

13.5

1.11

38

10.5

9

1.17

11

9.5

1.16

10.5

10

1.05

10.5

9.5

1.11

14

12

1.17

14

13

1.08

39

9.5

9

1.06

10.5

10

1.05

11

10

1.1

10.5

10.5

1

13

10

1.3

14

13.5

1.04

40

10

8.5

1.18

12.5

10.5

1.19

10.5

9.5

1.11

10

9

1.11

11.5

11

1.05

13

13

 

41

10.5

9.5

1.11

11

9.5

1.16

10

9.5

1.05

10

9

1.11

13.5

10.5

1.29

14.5

12.5

1.16

42

11.5

10.5

1.1

11.5

11

1.05

10

10

1

10.5

10

1.05

12.5

9.5

1.32

13

12

1.08

43

11

10.5

1.05

10

10

1

10.5

9.5

1.11

10.5

9.5

1.11

13.5

11

1.23

13.5

11.5

1.17

44

10

9

1.11

11

9.5

1.16

10.5

10

1.05

10

10

1

14

12

1.17

14

11.5

1.22

45

10.5

8.5

1.24

11.5

10

1.15

10.5

9.5

1.11

12

10

1.2

13.5

10.5

1.29

13

11.5

1.13

46

10.5

8

1.31

11.5

11.5

1

10.5

9.5

1.11

10.5

10

1.05

14

12

1.17

13.5

12

1.13

47

12.5

10.5

1.19

11

10.5

1.05

9.5

8.5

1.12

9.5

9.5

1

12

11.5

1.04

12.5

11.5

1.09

48

11

9.5

1.16

10.5

10

1.05

10

10

1

11.5

10

1.15

13.5

12

1.13

13.5

11.5

1.17

49

11

9.5

1.16

11.5

9.5

1.21

10.5

9.5

1.11

10.5

10

1.05

13

11.5

1.13

13

12

1.08

50

10

9.5

1.05

11.5

9.5

1.21

11

10.5

1.05

10.5

8

1.31

13.5

12

1.13

13

12.5

1.04

51

10

9.5

1.05

10

8.5

1.18

10

9

1.11

11

9

1.22

14

11.5

1.22

12.5

10.5

1.19

52

10.5

8.5

1.24

10.5

8

1.31

10

11

0.91

10.5

10.5

1

13.5

10.5

1.29

14.5

12

1.21

53

12

9.5

1.26

10

8.5

1.18

9

9

1

11.5

10

1.15

14

11.5

1.22

14

12

1.17

54

10.5

10.5

1

11

8.5

1.29

10

9.5

1.05

10.5

9

1.17

13

12

1.08

13.5

12

1.13

55

10.5

10.5

1

12

9.5

1.26

10

9.5

1.05

10

10

1

12

11

1.09

14

12

1.17

56

11

10

1.1

9.5

9

1.06

9.5

9.5

1

10.5

10.5

1

12

12

1

13

13

1

57

10.5

9

1.17

10

8.5

1.18

11.5

10.5

1.1

11

9.5

1.16

13

10.5

1.24

14

13

1.08

58

10

10

1

11.5

9.5

1.21

10

9

1.11

10.5

10

1.05

14.5

10.5

1.38

13

12.5

1.04

59

11

10

1.1

11

10

1.1

10

7.5

1.33

10.5

9.5

1.11

13

11.5

1.13

13.5

12

1.13

60

10.5

10.5

1

12

9.5

1.26

10

10

1

10

9.5

1.05

13

12

1.08

14.5

12

1.21

61

10.5

8.5

1.24

11

10

1.1

10.5

10

1.05

10.5

9.5

1.11

13.5

10

1.35

14.5

13

1.12

62

11.5

9

1.28

10.5

10

1.05

11

9

1.22

10.5

10

1.05

13

11.5

1.13

14.5

13

1.12

63

10.5

8.5

1.24

10.5

9.5

1.11

10.5

9.5

1.11

9.5

9.5

1

12.5

12

1.04

13.5

12

1.13

64

10.5

9.5

1.11

10.5

10

1.05

11

10.5

1.05

10

9.5

1.05

12.5

12

1.04

14

12.5

1.12

65

10

10

1

10

8.5

1.18

10.5

10.5

1

11

9

1.22

14.5

10.5

1.38

13

12.5

1.04

66

10.5

8.5

1.24

11.5

11

1.05

11

11

1

10.5

8.5

1.24

11.5

10.5

1.1

13

12.5

1.04

67

11

10.5

1.05

11

9.5

1.16

11.5

10

1.15

11

9.5

1.16

15

12

1.25

13.5

12.5

1.08

 

10.5

8.5

1.24

11

9.5

1.16

11

11

1

10.5

9.5

1.11

12.5

11

1.14

14

13

1.08

69

10

10

1

11.5

10.5

1.1

11.5

11

1.05

10

9

1.11

14

11

1.27

14.5

14

1.04

70

10

10

1

11.5

11

1.05

10

9.5

1.05

11

10

1.1

12

11

1.09

13.5

12.5

1.08

71

11

9

1.22

11

10

1.1

9

9

1

10.5

9

1.17

13

10.5

1.24

13

12.5

1.04

72

10

10

1

10.5

10

1.05

10

9.5

1.05

11

10.5

1.05

 

12

1.08

13.5

12.5

1.08

73

10

10

1

13

10

1.3

11

10

1.1

9.5

9

1.06

11.5

11.5

1

13.5

13

1.04

74

10.5

8

1.31

11

9

1.22

10.5

9.5

1.11

11

9.5

1.16

14

11

1.27

13.5

13

1.04

75

10

9.5

1.05

11.5

10

1.15

10.5

9.5

1.11

10.5

10.5

1

12

10.5

1.14

15.5

13.5

1.15

76

11.5

9

1.28

12

10.5

1.14

11

9.5

1.16

10.5

10

1.05

11.5

9

1.28

13

12.5

1.04

77

11

10

1.1

10.5

10

1.05

9

9

1

11.5

9.5

1.21

12.5

11

1.14

14

12.5

1.12

78

11.5

9.5

1.21

10.5

10

1.05

9.5

9.5

 

9.5

8.5

1.12

11

10.5

1.05

14.5

12

1.21

79

11

9

1.22

11.5

8.5

1.35

11

10

1.1

10

9

1.11

13

11

1.18

13.5

12

1.13

80

11.5

9.5

1.21

10.5

9.5

1.11

10

8.5

1.18

11

8.5

1.29

11.5

11

1.05

13.5

12.5

1.08

81

9.5

9.5

1

11

9.5

1.16

10.5

10

1.05

11.5

9

1.28

11.5

11

1.05

13.5

10.5

1.29

82

11

9.5

1.16

10.5

10

1.05

11

9.5

1.16

10.5

10

1.05

12.5

11

1.14

13

13

1

83

10.5

10.5

1

11.5

9

1.28

11.5

9.5

1.21

11

9.5

1.16

12.5

12

1.04

14.5

13

1.12

84

11.5

10

1.15

11

9

1.22

10

9.5

1.05

10

9.5

1.05

12

9.5

1.26

13.5

12.5

1.08

85

11

10

1.1

10

10

1

11

9.5

1.16

10

8

1.25

13.5

11

1.23

14

13

1.08

86

11

9

1.22

10.5

9.5

1.11

11.5

11

1.05

9.5

7.5

1.27

14

9.5

1.47

14

12

1.17

87

11

10.5

1.05

10.5

9

1.17

11.5

10.5

1.1

11

8.5

1.29

12.5

12

1.04

15

13.5

1.11

88

11

9

1.22

11

9.5

1.16

10

9

1.11

10

9

1.11

12

12

1

12.5

12.5

1

89

10

7.5

1.33

11.5

8.5

1.35

9.5

9

1.06

10

9.5

1.05

15

12.5

1.2

13.5

11.5

1.17

90

11

9.5

1.16

10

9.5

1.05

11

9.5

1.16

11

10

1.1

14.5

12

1.21

12

12

1

91

10.5

9

1.17

13.5

11

1.23

11

9.5

1.16

11

10.5

1.05

12

11.5

1.04

13.5

13

1.04

92

10.5

9

1.17

13.5

10.5

1.29

9.5

9.5

1

11.5

10

1.15

14

11

1.27

13

12

1.08

93

10

8.5

1.18

13

10.5

1.24

9.5

7.5

1.27

11.5

9.5

1.21

13.5

11

1.23

14

12.5

1.12

94

11

9.5

1.16

11.5

10.5

1.1

11

11

1

10.5

9.5

1.11

13

11

1.18

13.5

11.5

1.17

95

10.5

9

1.17

11

11

1

11

10

1.1

10.5

10

1.05

14.5

12

1.21

14.5

12

1.21

96

10.5

7.5

1.4

12

10.5

1.14

10.5

8.5

1.24

10.5

9.5

1.11

12.5

10.5

1.19

14.5

13

1.12

97

11.5

9.5

1.21

11

11

1

10.5

10

1.05

10.5

9.5

1.11

12.5

11.5

1.09

13

11

1.18

 

11.5

9.5

1.21

11

9

1.22

13

11

1.18

11

10

1.1

11.5

11

1.05

13.5

11.5

1.17

99

13.5

11.5

1.17

10.5

10

1.05

10

9

1.11

10.5

9.5

1.11

12.5

11.5

1.09

14.5

13.5

1.07

100

10.5

9.5

1.11

11

10

1.1

10

10

1

11

9.5

1.16

13.5

12.5

1.08

13.5

11.5

1.17

Taxonomy

Based on our phylogenetic analyses, the following nomenclature and taxonomic changes are proposed for leaf stripe smuts caused by species of Ustilago. The positions given for the diagnostic bases refer to specific positions in the alignments as highlighted in the alignment consensus sequences in Fig. 4. Only selected synonyms are given here. For a complete synonymy reference should be made to Vánky (2012) and references therein.

Ustilago agrostidis-palustris W. H. Davis ex Ciferri, Ann. Mycol. 29: 54 (1931).

Type: USA: Wisconsin: Madison, on cultivated ‘redtop’ (i.e. Agrostis “palustris Huds.”, now Agrostis gigantea), 8 July 1921, W. H. & J. J. Davis (BPI 166994 — lectotype designated here, MBT 380628).

Confirmed host: Agrostis gigantea.

Confirmed distribution: Germany and USA.

Notes: Ustilago agrostidis-palustris can be distinguished from other leaf stripe smuts of the U. striiformis species complex based on its host specific occurrence on Agrostis gigantea s. lat. Furthermore, it differs in one diagnostic base from all other species of the U. striiformis-complex included in this study — in the sdh1 gene there is a C instead of a T at position 138 (Table 2, Fig. 6).
Fig. 6
Fig. 6

Alignment consensus sequences for the alignments used in this study with positions of diagnostic bases highlighted in bold face.

Ustilago airae-caespitosae (Lindr.) Liro, Ann. Acad. Sci. Fenn., ser. A 17 (1): 71 (1924).

Basionym: Tilletia airae-caespitosae Lindr., Acta Soc. Fauna Flora Fenn. 26:15 (1904).

Type: Finland: Nyland: Helsingfors, Hagasund, on Aira caespitosa (i.e. Deschampsia caespitosa), 10 Aug. 1902, J. I. Lindroth [Vestergren, Micr. Rar. Sel. no. 806; Sydow, Ustil. no. 316] (M-0236198 — lectotype designated here, MBT 380628; from one of the several duplicate collections treated as “lectotype” by Lindeberg, Symb. Bot. Upsal. 16 (2): 135, 1959).

Confirmed host: Deschampsia caespitosa.

Confirmed distribution: Austria and Finland.

Notes: Within the Ustilago striiformis species complex, U. airae-caespitosae can be distinguished from other species based on the host-specific occurrence on Deschampsia caespitosa. Furthermore, it differs in six diagnostic bases from all other species within the U. striiformis species complex included in this study — in the atp2 gene it has an A instead of a G at position 22 and 94, in the map gene there is a T instead of a C at position 227, in the myosin gene there is an A instead of a G at position 133, in the rpl3 gene a T instead of a C at position 199, and an A instead of a G at position 576 in the ITS region (Table 2, Fig. 6).

Ustilago alopecurivora (Ule) Liro, Ann. Acad. Sci. fenn., ser. A 17 (1): 72 (1924).

Basionym: Tilletia alopecurivora Ule, Hedwigia 25: 113 (1886).

Synonyms: Uredo longissima var. megalospora Riess, in Rabenhorst, Herb. Viv. Myc. no. 1897 (1854).

Ustilago megalospora (Riess) Cif., Nuovo Giorn. Bot. Ital. 40: 261 (1933).

Type: Germany: Bavaria: Coburg, Hofgarten, on Alopecurus pratensis, June 1879, E. Ule (B — holotype lost); Berlin: Charlottenburg-Nord, Kolonie Königsdamm, slope of ditch, 9 Aug. 1988, H. Scholz (B 70 0014985 — neotype designated here, MBT 380629).

Confirmed host: Alopecurus pratensis.

Confirmed distribution: Germany.

Notes: Within the U. striiformis species complex, U. alopecurivora can be distinguished from other species based on the host-specific occurrence on Alopecurus pratensis. Furthermore, U. alopecurivora differs in three diagnostic bases from all other species within the U. striiformis species complex included in this study — in the atp2 gene, there is an A instead of a G at position 358, in the map gene there is a G instead of a T at position 192, and in the myosin gene there is a T instead of a C at position 83 (Table 2, Fig. 6).

Ustilago brizae (Ule) Liro, Ann. Acad. Sci. Fenn., Ser. A 17 (1): 74 (1924).

Basionym: Tilletia brizae Ule, Verh. Bot. Ver. Prov. Brandenb. 25: 214 (1884).

Type: Germany: Bavaria: Coburg, Rögener Berg, on Briza media, July 1879, E. Ule [Rabenhorst, Fungi Eur. no. 3604] (M-0147750 — lectotype designated here, MBT 380630; from one of the several duplicate collections treated as “lectotype” by Lindeberg, Symb. Bot. Upsal. 16(2): 135, 1959).

Confirmed hosts: Briza media.

Confirmed distribution: Austria and Germany.

Notes: Within the U. striiformis species complex, U. brizae can be distinguished from other species based on the host-specific occurrence on Briza media. Furthermore, U. brizae differs in one diagnostic base from all other species within the U. striiformis species complex included in this study, except U. bromina on Bromus inermis, in having a C instead of a T at position 621 in the ITS region, and differs from U. bromina by having an A instead of a G at position 223 in the ITS region (Table 2, Fig. 6).

Ustilago corcontica (Bubák) Liro, Ann. Acad. Sci. Fenn., Ser. A 17 (1): 383 (1924).

Basionym: Tilletia corcontica Bubák, Houby Ceské, Hemibasidii 2: 47 (1912).

Type: Czech Republic: on the crest of Riesengebirge Mts, on Calamagrostis halleriana (i.e. C. villosa), 20 July 1872, J. Gerhardt (BPI 172761 — lectotype designated here, MBT 380631; one of the “isolectotypes” of Lindeberg, Symb. Bot. Upsal. 16(2): 114, 1959).

Confirmed host: Calamagrostis villosa.

Confirmed distribution: Czech Republic and Germany.

Notes: Within the U. striiformis species complex, U. corcontica can be distinguished from other species based on the host-specific occurrence on Calamagrostis villosa. Furthermore, U. corcontica differs in one diagnostic bases from all other species within the U. striiformis species complex included in this study — in the atp2 gene there is an T instead of a C at position 535 (Table 2, Fig. 6).

Ustilago denotarisii A. A. Fischer v. Waldheim, Aperçu Syst. Ustil.: 22 (1877); as “de Notarisii”.

Type: Italy: on Arrhenatherum spp. (not located but could also not be confirmed as lost; a neotype may need to be designated for this species in the future).

Confirmed hosts: Arrhenatherum species.

Confirmed distribution: Germany and Italy.

Notes: Spores globose to ovoid, standard range (9.0−)10.5– (av. 11.2)−12.0 (−13.5) × (8.0−) 9.0−(av. 9.7)−10.5(−12.0) µm, length/breadth ratio of 1.10− (av. 1.20) −1.38, olive-brown, and finely echinulate. Within the U. striiformis species complex, U. denotarisii can be distinguished from other species based on the host-specific occurrence on Arrhenatherum species. Furthermore, U. denotarisii differs in two diagnostic bases from all other species within the U. striiformis species complex included in this study — in the atp2 gene there is an A instead of a G at position 346, and in the gene ssc1 there is an A instead of a C at position 182 (Table 2, Fig. 6).

Ustilago echinata J. Schröt., Abh. Schles. Ges. Vaterl. Kult., Abth. Naturwiss.: 48: 4 (1870 [“1869”].

Type: Poland: Silesia: ‘Schwarzwasserbruch’, near Legnica, on Phalaris arundinacea, June 1869, W. G. Schneider [Rabenhorst, Fungi Eur. no. 1497] (FR — lectotype designated here, MBT 380632; one of the several duplicate collections previously treated as “lectotype” in Rabenhorst, Fungi Eur. No. 1497).

Reported hosts: Glyceria grandis, Phalaris arundinacea, and Scolochloa festucacea.

Confirmed host: Phalaris arundinacea.

Known distribution: Asia, North America, and Europe.

Notes: This species shares one sequence motif (AACCCAAC) at positions 20–27 in the ITS region with other coarsely ornamented stripe smuts (U. serpens clade in Fig. 1), and many SNPs which distinguish U. echinata from species of the U. striiformis-complex. Within the U. serpens-complex, U. echinata can be distinguished from other species based on its host-specific occurrence on Phalaris arundinacea (type host). Whether the other hosts of a similar ecotype are infected by the same species could not be clarified in the current study, but the high degree of host specificity observed in Ustilago renders it possible that specimens from other host genera will have to be described as new species. Furthermore, U. echinata differs in eight diagnostic bases from all other species within the U. serpens species complex included in this study — in the atp2 gene there is a G instead of an A at position 85, in the map gene there is an A instead of a G at position 208, in the myosin gene there is a C instead of an A at position 141 and a T instead of a C at position 156, in the rpl3 gene there is a T instead of a C at position 91 and an A instead of a G at position 146, in the sdh1 gene there is an A instead of a G and at positions 58 and 256, and in the ITS locus there is a C instead of an A at position 19, a C instead of a T at position 38, an A instead of a gap at position 186 and 596 and a G instead of an A at positions 188 and 604 (Tab. 2, Fig. 6).

Due to the generally narrow host specificity of smut fungi, it is conceivable that U. echinata will be revealed to be a species group.

Ustilago jagei J. Kruse & Thines, sp. nov. MycoBank MB819627

(Fig. 5A-B)

Etymology: Named after mycologist Horst Jage from Kemberg (Germany), who has made significant contributions to the knowledge of phytopathogenic fungi and has enabled well-sampled phylogenetic investigations in various plant pathogens by his outstanding collections.

Diagnosis: Within the U. striiformis species complex, U. jagei can be distinguished from other species based on its host-specific occurrence on Agrostis stolonifera s. lat. Furthermore, U. jagei differs in two diagnostic bases from all other species within the U. striiformis species complex included in this study — in the atp2 gene there is an A instead of a G at position 466 and in the gene rpl3 there is an A instead of a G at position 92 (Table 2, Fig. 6).

Type: Germany: Saxony-Anhalt: Dessau, Kühnauer Sea, southern shore east-southeast of Großkuhnau, wayside, on Agrostis stolonifera, 16 Sept. 2001, H. Jage (GLM-F047379 — holotype).

Description: Sori as long narrow streaks parallel to vascular bundles, mostly in the leaves, rarely ascending into the inflorescence, initially covered by the epidermis of the plants, which soon frays. Spore mass dark brown to almost black, powdery. Infection systemic, infected plants usually sterile. Spores globose to ovoid, (9.5−) 10.0−(av. 10.9) −11.5(−13.5) x (7.5−) 8.5−(av. 9.3)−10.0(−11.5) µm, length/breadth ratio 1.04−(av. 1.24)−1.5, olive-brown, finely echinulate (Table 3, Figs 34).

Confirmed hosts: Agrostis rupestris and A. stolonifera.

Confirmed distribution: Germany and Switzerland.

Notes: It seems possible that U. jagei on Agrostis stolonifera s. lat. represents a species complex, and further investigations with more specimens and additional gene loci are needed to clarify this situation.

Ustilago kummeri J. Kruse & Thines, sp. nov. MycoBank MB819628

(Fig. 5I-J)

Etymology: Named after the mycologist Volker Kummer from Potsdam (Germany), who has made significant contributions to the knowledge of phytopathogenic fungi and has enabled well-sampled phylogenetic investigations in various plant pathogens by his outstanding ability to recognise easily overlooked plant pathogens.

Diagnosis: Differs from species of the U. striiformis species complex in the larger spores and taller warts. Furthermore, U. kummeri shares one sequence motif at positions 20–27 (AACCCAAC) with other coarsely ornamented stripe smuts, and many SNPs distinguishing it from species of the U. striiformis species complex. Within the U. serpens-complex, U. kummeri can be distinguished from other species based on the host-specific occurrence on Bromus inermis. Furthermore, U. kummeri differs in two diagnostic bases from U. serpens on Elymus repens — in the ITS region there is an C instead of a G at position 260 and G instead of an A at position 629 (Table 2, Fig. 6).

Type: Germany: Brandenburg: Middlemark, Uetz: Hinterer Werder, southwest corner between Sacrow-Paretzer-Channel und Havel-Channel, on Bromus inermis, 19 June 2010, V. Kummer (GLM-F107435 — holotype; VK 2577/17 isotype).

Description: Sori as long, narrow streaks parallel to vascular bundles, mostly in the leaves, rarely ascending to the inflorescence, initially covered by the epidermis of the plants, which soon frays. Spore mass dark brown, powdery. Infection systemic, infected plants mostly sterile. Spores ovoid to globose, (11.0−) 12.0− (av. 13.0) −14.0 (−15.5) × (9.0−) 10.5− (av. 11.5) −12.0 (−13.5), length/breadth ratio 1.04− (av. 1.15) −1.41, olive-brown, coarsely verrucose to echinulate (Table 3, Figs 56).

Confirmed host: Bromus inermis. Confirmed distribution: Germany.

Notes: It seems likely that additional species will be discovered in the U. serpens clade once more stripe-smuts with coarse spore ornamentation will be scrutinised.

Ustilago loliicola Ciferri, Fl. Ital. Crypt., Par. I. Fungi, Fasc. 17: 345 (1938).

Type: Germany: Berlin: Berlin-Weissensee, on Lolium perenne, Sept. 1877, E. Ule [Rabenhorst, Fungi Eur. no. 2491] (FR — lectotype designated here, MBT 380633; from one of the several duplicate collections treated as “lectotype” by Lindeberg, Symb. Bot. Upsal. 16 (2): 136, 1959).

Confirmed hosts: Festuca arundinacea s. lat. and Lolium perenne.

Confirmed distribution: Germany.

Notes: Within the U. striiformis species complex, U. loliicola can be distinguished from other species based on the specific occurrence on the closely related hosts Festuca arundinacea s. lat. and Lolium perenne. Furthermore, U. loliicola differs in four diagnostic bases from all other species within the U. striiformis species complex included in this study — in the ssc1 locus there is an A instead of a G at positions 210, 214 and 231, and a T instead of a C at position 243 (Table 2, Fig. 6).

Ustilago milii (Fuckel) Liro, Ann. Acad. Sci. Fenn., ser. A 17 (1): 78 (1924).

Basionym: Tilletia milii Fuckel, Jb. nassau. Ver. Naturk. 23–24: 40 (1870).

Type: Germany: Hesse: Rabenkopf Mt., near Oestrich, on Milium effusum, L. Fuckel [Fungi Rhenani no. 2410] (FR -lectotype designated here, MBT 380634, from one of the several duplicate collections treated as “lectotype” in Fuckel, Fungi Rhenani no. 2410).

Confirmed host: Milium effusum.

Confirmed distribution: Germany.

Notes: Within the U. striiformis species complex, U. milii can be distinguished from other species based on the host-specific occurrence on Milium effusum. Furthermore, U. milii differs in two diagnostic bases from all other species within the U. striiformis species complex included in this study — in the atp2 gene there is an A instead of a G at position 301, and in the ITS there is a T instead of a C at position 206 (Table 2, Fig. 6).

Ustilago neocopinata J. Kruse & Thines, sp. nov. MycoBank MB819630

(Fig. 5E-F)

Etymology: Highlights the unexpected finding that there are several distinct and host-specific species within the U. striiformis species complex.

Diagnosis: Within the U. striiformis species complex, U. neocopinata can be distinguished from other species based on the host-specific occurrence on Dactylis glomerata. Furthermore, U. neocopinata differs in five diagnostic bases from all other species within the U. striiformis species complex included in this study — in the ssc1 gene there is an A instead of a G at positions 69 and 198, in the rpl4A gene there is a T instead of a C at position 120, in the rpl3 gene there is an A instead of a G at position 40, and in the ITS region there is an A instead of a G at position 617 (Table 2, Figs 56).

Type: Germany: Bavaria: Upper Franconia, Kronach county, Wallenfels, in the direction of the sewage treatment plant downstream of Stumpfenschneidmühle, on Dactylis glomerata, 15 July 2012, J. Kruse (GLM-F107413 — holotype).

Description: Sori as long small streaks parallel to vascular bundles, mostly in the leaves, very rarely ascending to the inflorescence, initially covered by the epidermis of the plants, which soon frays. Spore mass dark brown to almost black, powdery. Infection systemic, infected plants mostly sterile. Spores mostly globose, rarely ovoid, (9.0−) 10.0− (av. 70.5−11.0 (−13.0) × (7.5−) 9.0− (av. 9.8) −10.5 (−11) µm, length/breadth ratio 1.00− (av. 1.07) −1.18, olive-brown, finely echinulate (Table 3, Figs 56).

Notes: As the host is widespread throughout the Holarctic region, it is conceivable that the species will prove to have a much wider distribution range than currently known.

Ustilago salweyi Berk. & Broome, Ann. Mag. Nat. Hist. 5: 463 (1850).

(Fig. 5GH)

Type: UK: Channel Islands: Guernsey, St Martin’s, on Holcus lanatus [originally misidentified as Dactylis glomerata fide Hubbard, in Stevenson, Plant Dis. Rep. 30: 57, 1946], 1847, T. Salwey (K-M — holotype; K-M00022071 — isotype).

Synonyms: Uredo striiformis Westend., Bull. Acad. R. Sci. Belg., cl. sci. 18: 406 (1852); as “striaeformis”.

Uredo salveii (Berk. & Broome) Oudem., Prodromus Florae Bataviae, 2nd edn,4: 180 (1866).

Tilletia debaryana A.A. Fisch. Waldh., in Rabenhorst, Fungi eur. no. 1097 (1867).

Tilletia striiformis (Westend.) Magnus, Malpighia 1: 8 (1875). Ustilago striiformis (Westend.) Niessl, Hedwigia 15: 1 (1876). Tilletia salveii (Berk. & Broome) P. Karst., Bidrag. Kännedom. Finlands Naurt. Folk. 6: 102 (1884).

Confirmed hosts: Holcus lanatus and H. mollis.

Confirmeddistribution: Belgium, Germany, and UK.

Notes: Spores globose to ovoid, standard range (9.5−)10.0− (av. 10.6) −11.0 (−12.5) × (7.5−) 9.0−(av. 9.4)−10.0(−10.5) µm, finely echinulate, length/breadth ratio 1.00−(av. 1.15)−1.39. Within the U. striiformis species complex, U. salweyi can be distinguished from other species based on the host-specific occurrence on Holcus lanatus and H. mollis. Furthermore, U. salweyi differs in three diagnostic bases from all other species within the striiformis species complex included in this study — in the rpl4A gene there is a T instead of a C at position 85, in rpl3 there is a T instead of a C at position 133, and in the ITS region there is an A instead of a G at positions 103 (Table 2, Fig. 6).

The original host was misidentified as Dactylis glomerata, but this was found to be incorrect and actually Holcus lanatus by the leading grass specialist C.E. Hubbard (in Stevenson 1946). David Hawksworth also studied the type materials in K-M and concurs. Hosts in their vegetative stage can be misidentified, as some characteristics, such as leaf shape, ligula, and general habit can be modified as a consequence of infection.

Ustilago scaura Liro s. lat., Ann. Acad. Sci. Fenn., ser. A, 17(1): 73 (1924).

Replaced name: Tilletia avenae Ule, Verh. Bot. Vereins Prov. Brandenburg 25: 214 (1884).

Type: Germany: Bavaria: Coburg, Fortress, on Avena pratensis (i.e. Helictotrichon pratense), June 1879, E. Ule (s. n. — lost); Hesse: county Tann/Rhön, at Galgenmount, on Avena pubescens [now, Helictotrichon pubescens], 16 Sept. 1990, H. Scholz (B 70 0014830 — neotype designated here, MBT 380637).

Non Ustilago avenae (Pers.) Rostrup, Overs. K. danske Vidensk. Selsk. Forh. Medlemmers Arbeider: 13 (1890).

Confirmed host: Helictotrichon pubescens, H. pratense?

Confirmed distribution: Germany.

Notes: Within the U. striiformis species complex, U. scaura s. lat. can be distinguished from other species based on the host-specific occurrence on Helictotrichon pratense and H. pubescens. Furthermore, U. scaura s. lat. differs in one diagnostic base from all other species within the U. salweyi species complex included in this study, except U. denotarisii on Arrhenatherum spp., in having a T instead of a C at position 628 in the ITS region, and from U. denotarisii on Arrhenatherum elatius in having a 13 nucleotide deletion at positions 222–241 in the ITS alignment (Table2, Fig. 6).

Since the type has been lost, we designate a neotype for Ustilago scaura with material on the closely related H. pubescens.

Ustilago scrobiculata Liro, Ann. Acad. Sci. Fenn., ser. A 17(1): 68 (1924).

Type: Finland: Nyland: Pornainen, Kirveskoski, on Calamagrostis arundinacea, 9 Aug. 1916, T. Putkonen & J. I. Liro (H — lectotype, designated by Lindeberg, Symb. Bot. Upsal. 16 (2): 130 (1959).

Synonym: ? Ustilago deyeuxiae L. Guo, Mycosystema 6: 51 (1993).

Reported hosts: Calamagrostis spp. (see Vánky 2012: 1265).

Reported distribution: Asia and Europe.

Notes: This species shares one sequence motif with other coarsely ornamented stripe smuts (AACCCAAC at positions 20–27), which distinguishes it from species of the Ustilago striiformis species complex, and many additional single SNPs. Within the U. serpens species complex, U. scrobiculata differs in 21 diagnostic bases from other species (Table 2, Fig. 6). It seems possible that U. deyeuxiae has not been sampled on Calamagrostis arundinacea, as the host of U. deyeuxiae is given as “Deyeuxia arundinacea” by Guo (1993), which is often seen as a synonym of D. pyramidalis in Asian literature (e.g. Shenglian et al. 2006). Thus, it seems possible that the species needs to be reconsidered as independent from U. scrobiculata once sequence data from the type specimen become available.

Ustilago serpens (P. Karst.) B. Lindeb., Symb. Bot. Upsal. 16(2): 133 (1959).

Basionym: Tilletia serpens P. Karst., Fungi Fenn. Exs., fasc. 6: no. 599 (1866).

Type: Finland: Merimasku, on “Dactylis glomerata” [re-determined as Elymus repens by Lindeberg, Symb. Bot. Upsal. 16(2): 133, 1959], July 1862, P. Karsten [Fungi Fenn. Exs no. 599] (HUV 10432 — lectotype designated here; MBT 380638 from one of the several duplicate collections treated as “lectotype” by Lindeberg, Symb. Bot. Upsal. 16(2): 133, 1959).

Confirmed host: Elymus repens.

Confirmed distribution: Finland and Germany.

Notes: The spores are small to medium sized, (11.5−) 13.0− (av. 13.5) 14.5 (−15.5) × (10.5−) 11.5 (av. 12.5) −13.0 (−14.0) µm, with a length/breadth ratio of 1.00−(av. 1.09)−1.23 and with coarsely verrucose ornamentation. This species shares one sequence motif with other coarsely ornamented stripe smuts (AACCCAAC at position 20−27), which distinguishes it from species of the U. striiformis species complex and many additional SNPs. Within the U. serpens-complex, U. serpens can be distinguished from other species based on four diagnostic bases: in the myosin gene there is an A instead of G at position 93, in rpl4A gene there is a T instead of a C at position 232 and in the ITS locus there is a C instead of a T at position 260, and a G instead of an A at position 629 (Table 2, Fig. 6).

Vánky (2012) lists several additional hosts for U. serpens. Due to the narrow specialization of stripe-smut revealed in this study, however, it seems likely that these harbour several distinct species. Until sequence data become available for these host-pathogen combinations, Ustilago on these other hosts is probably best referred to as U. serpens s. lat.

Discussion

In this study, the closely related species of the Ustilago striiformis-complex and some other leaf stripe Ustilago smuts were investigated using multigene phylogenetic reconstructions to clarify their relationships. In total, 62 specimens of the U. striiformis species complex (incl. U. calamagrostidis) and four other leaf stripe smuts (U. echinata, U. fliformis, U. scrobiculata, and U. serpens s. lat.) were studied.

Phylogenetic analyses provided strong support for the polyphyly of the leaf-stripe smuts within Ustilago. However, the multilocus-based phylogenetic trees support the monophyly of the U. striiformis species complex, in contrast to the analysis by Savchenko et al. (2014a), where it was concluded that the U. striiformis group was polyphyletic and the segregation of two species was necessary to render it monophyletic. That interpretation was mainly based on a combined LSU-ITS tree of U. striiformis species, where U. bromina and U. nunavutica were located outside the U. striiformis s. lat. clade. Because of this conflicting result, the ITS region of the type specimen of U. bromina was sequenced (Table 1) and compared with the deposited GenBank sequences of Savchenko et al. (2014a). The type specimen of U. bromina on Bromus inermis had an ITS sequence nearly identical (except for a base exchange in a poly A/T region) with the other specimens identified as this species in the current study. It differed in nine bases compared to the three sequences labelled as U. bromina in Savchenko et al. (2014a). It is conceivable that these specimens belong to another undescribed smut species (the three sequences were obtained from material from Israel and USA, while the type collection was from Germany), or the quality of the sequences was not optimal; almost all differences in the sequences from Savchenko et al. (2014a) in comparison to the sequences from this study were located behind a poly A/T site, which necessitated re-sequencing for several of the specimens used in this study. Furthermore, misidentification of the host plant seems also possible, as no records were found for the occurrence of Bromus inermis in the floras of Israel (https://doi.org/flora.org.il/en/plants/) or Palestine (Feinbrun-Dothan 1986).

Ustilago nunavutica was the second species that led Savchenko et al. (2014a) to assume that the U. striiformis species complex was polyphyletic. Comparing the ITS and LSU sequences of U. nunavutica with sequences from the current study, the LSU sequence used by Savchenko et al. (2014a) showed several SNPs (data not shown), while all other U. striiformis samples investigated in this study were identical in the LSU region. In contrast, the ITS sequence of U. nunavutica has only few SNPs in comparison to other members of the U. striiformis species complex and is identical with U. neocopinata. It seems possible that the LSU sequence of U. nunavutica either was of bad quality or shows the amplification of a contaminant smut fungus. However, as the genera Puccinellia and Dactylis are not closely related (Schneider et al. 2009) and very high host specificity has been revealed for the closely related species of the U. striiformis species complex in this study, it is unlikely that U. neocopinata and U. nunavutica are conspecific.

In agreement with Stoll et al. (2005) and Spooner & Legon (2006), we found that U. calamagrostidis and U. corcontica belonged to the U. striiformis species complex. However, further resolution within the U. striiformis species complex was only achieved when the protein-coding loci introduced by Kruse et al. (2017b) were employed. The trees revealed a host genus or host species specific occurrence for almost all lineages within the U. striiformis species complex, thus they should be treated as distinct species, supported by the observations of Liro (1924). All specimens from a single host species formed a clade according to the host species (or the host genus, in case of Holcus), with the exception of the rather closely related species Lolium perenne and Festuca arundinacea (Malik & Thomas 1966, Catalán et al. 2004, Hand et al. 2010). As most of these clades received high to maximum support, they should be considered to represent distinct species, which can be distinguished based on the host and diagnostic SNPs (Fig. 6). For most of the 14 lineages of the U. striiformis species complex validly published names are available, necessitating the description of only two new species in this complex, U. neocopinata on Dactylis glomerata and U. jagei on Agrostis stolonifera s. lat. Vánky (2012) and Savchenko et al. (2014a) mentioned that different species on different hosts within this complex vary remarkably in spore shape, size, and ornamentation. However, morphological variation was observed to be high even within the same host species in the current study and also by Vánky (2012). Thus it is difficult to distinguish these closely related species based on morphology, necessitating the consideration of hosts and SNPs for diagnosis. The host range of at least two species of Ustilago parasitic to Agrostis could not be inferred with certainty, as both ITS and chloroplast loci did not resolve closely related species in the A. stolonifera and A. gigantea clusters (Amundsen & Warnke 2012).

While investigating synonymies of the U. striiformis species complex, it was found that the name U. salweyi is the correct name for the stripe smut on Holcus lanatus. Stevenson (1946)flagged U. salweyi as a “nomen ambiguum”, although no action was taken to formally reject the name. Following the ICN (McNeill et al. 2012), the name U. salweyi has priority over Uredo striiformis as it was published two years earlier (Berkeley & Broome 1850: 463). Although the group generally referred to as the U. striiformis-group does not contain a species with that as the correct name, as it is still included as a synonym we feel that it is best to continue to use “U. striiformis-group” or “species complex” for these fungi as it is so well established and recalls the symptoms all species of the complex exhibit, although this feature is shared by some leaf-stripe smuts not belonging to this complex.

The species within the U. striiformis species complex have sometimes been recognised as special forms based on infection trials (Liro 1924, Davis 1930, 1935, Fischer 1940). However, it has been shown for various biotrophic pathogens that the special form concept, in which there is a population continuum with somewhat specialised forms, cannot be upheld (Göker et al. 2004, Lutz et al. 2005, Kemler et al. 2009, Thines et al. 2009, Ploch et al. 2011, Savchenko et al. 2014b, Choi & Thines 2015).

Similar to the situation in the U. striiformis species complex, Ustilago serpens s. lat. on different hosts clustered in phylogenetically distinct subgroups. As the type host for U. serpens is Elymus repens, the collections from Bromus inermis warrants recognition as a new species. Ustilago serpens is another example illustrating the narrow host specialization among smut fungi. As for both the coarsely ornamented stripe-smuts (U. serpens clade) and the finely ornamented stripe smuts (U. striiformis clade) only a subset of the known hosts could be included in the current study. It is therefore conceivable that some older names published for specific host-pathogen combinations in these groups warrant recognition and several new species await discovery.

With respect to the global phylogeny of Ustilago it is noteworthy that even based on nine loci the backbone of the phylogenetic tree was only poorly resolved. Conflicting supported topologies were inferred with respect to the phylogenetic position of U. maydis in the reconstructions based on three (sister to a clade comprising, among others, the U. nuda and the U. salweyi clade) and nine loci (sister to a clade comprising the majority of smuts on panicoid grasses).

This highlights the high degree of uncertainty that there still is with respect to the global phylogeny of Ustilago s. lat. (Thines 2016). Considering the diversity of anatomical characteristics and disease syndromes caused, many of which have arisen several times independently (such as the stripe-smut habit; McTaggart et al. 2012a, b, c), any splitting of Ustilago s. lat. into smaller genera as suggested by McTaggart et al. (2012a, 2016) is probably premature and might become obsolete due to the high degree of parallel evolution and associated homoplasy.

Declarations

Acknowledgements

This study was funded by the LOEWE research funding programme in the framework of the Cluster for Integrative Fungal Research (IPF). We are grateful to the curators of B (Berlin), GLM (Görlitz), M (Munich), and TUB (Tübingen) for allowing the investigation of specimens in their keeping, and David Hawksworth for important information on Ustilago salweyi types in K–M (Kew fungarium) and nomenclatural corrections. We furthermore want to thank the curators of B (Berlin), HBG (Hamburg) and L (Leiden) for searching for the type collection of Ustilago scaura. We thank the private collectors Horst Jage and Volker Kummer for allowing us to include some of their collections in this study. We want to thank Bagdevi Mishra for the opportunity to use TrEase (thines-lab@senckenberg.de/trease) for phylogenetic analysis. Furthermore, we are grateful to Y.-J. Choi for help with the primer design for an internal ITS primer and to Reuel Bennett for proof-reading an initial draft of the manuscript. MT and JK conceived the study; JK made collection trips; FK, HJ, HR, HZ, UR, WD, and VK provided material; JK performed laboratory experiments and microscopy, and also analysed the data; JK and MT interpreted the data and prepared the manuscript with contributions from the other authors.

This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Authors’ Affiliations

(1)
Faculty of Biosciences, Institute of Ecology, Evolution and Diversity, Goethe University Frankfurt am Main, Max-von-Laue-Str. 9, D-60438 Frankfurt am Main, Germany
(2)
Senckenberg Gesellschaft für Naturforschung, Biodiversity and Climate Research Centre (BiK-F), Senckenberganlage 25, D-60325 Frankfurt am Main, Germany
(3)
Barbara-Uthmann-Ring 68, 09456 Annaberg-Buchholz, Germany
(4)
Cluster for Integrative Fungal Research (IPF), Georg-Voigt-Str. 14-16, D-60325 Frankfurt am Main, Germany
(5)
Grillenburger Str. 8c, 09627 Naundorf, Germany
(6)
Traubenweg 8, 06632 Freyburg / Unstrut, Germany

References

  1. Amundsen K, Warnke S (2012) Agrostis species relationships based on trnL-trnF and atpI-atpH Intergenic Spacer Regions. Hortscience 47: 18–24.View ArticleGoogle Scholar
  2. Begerow D, Stoll M, Bauer R (2006) A phylogenetic hypothesis of Ustilaginomycotina based on multiple gene analyses and morphological data. Mycologia 98: 906–916.View ArticleGoogle Scholar
  3. Berkeley MJ, Broome CE (1850) Notices of British fungi. Annals and Magazine of Natural History 5: 455–467.View ArticleGoogle Scholar
  4. Catalán P, Torrecilla P, Ángel J, Rodríguez L, Olmstead RG (2004) Phylogeny of the festucoid grasses of subtribe Loliinae and allies (Poeae, Pooideae) inferred from ITS and trnL-F sequences. Molecular Phylogenetics and Evolution 31: 517–541.View ArticleGoogle Scholar
  5. Choi Y-J, Thines M (2015) Host jumps and radiation, not co-divergence drives diversification of obligate pathogens: a case study in downy mildews and Asteraceae. PLoS ONE 10(7): e0133655.View ArticleGoogle Scholar
  6. Davis WH (1930) Two physiologic forms of Ustilago striaeformis (Westd.) Niessl. Phytopathology 20: 65–74.Google Scholar
  7. Davis WH (1935) Summary of investigations with Ustilago striaeformis parasitizing some common grasses. Phytopathology 25: 810–817.Google Scholar
  8. Denchev C, Giraud T, Hood ME (2009) Three new species of anthericolous smut fungi on Caryophyllaceae. Mycologia Balcanica 6: 79–84.Google Scholar
  9. Feinbrun-Dothan N (1986) Flora Palaestina. Vol. 4. Jerusalem: Israel Academy of Sciences and Humanities, Section of Sciences.Google Scholar
  10. Fischer GW (1940) Fundamental studies on the stripe smut of grasses (Ustilago striaeformis) in the Pacific Northwest. Phytopathology 30: 93–118.Google Scholar
  11. Fischer GW (1953) Manual of the North American Smut Fungi. New York: Ronald Press.Google Scholar
  12. Göker M, Riethmüller A, Voglmayr H, Weiss M, Oberwinkler F (2004) Phylogeny of Hyaloperonospora based on nuclear ribosomal internal transcribed spacer sequences. Mycological Progress 3: 83–94.View ArticleGoogle Scholar
  13. Guo L (1993) Ustilago deyeuxiae sp. nov. and three smut species new to China. Mycosystema 6: 51–55.Google Scholar
  14. Hand ML, Cogan NOC, Stewart AV, Forster JW (2010) Evolutionary history of tall fescue morphotypes inferred from molecular phylogenetics of the Lolium-Festuca species complex. BMC Evolutionary Biology 10: 303.View ArticleGoogle Scholar
  15. Heller A, Thines M (2009) Evidence for the importance of enzymatic digestion of epidermal walls during subepidermal sporulation and pustule opening in white blister rusts (Albuginaceae). Mycological Research 113: 657–667.View ArticleGoogle Scholar
  16. Katoh K, Standley DM (2013) MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology and Evolution 30: 772–780.View ArticleGoogle Scholar
  17. Kemler M, Lutz M, Göker M, Oberwinkler F, Begerow D (2009) Hidden diversity in the non-caryophyllaceous plant-parasitic members of Microbotryum (Pucciniomycotina: Microbotryales). Systematics and Biodiversity 7: 297–306.View ArticleGoogle Scholar
  18. Kruse J, Choi Y-J, Thines M (2017a) New smut-specific primers for the ITS barcoding of Ustilaginomycotina. Mycological Progress 16: 213–221.View ArticleGoogle Scholar
  19. Kruse J, Mishra B, Choi Y-J, Sharma R, Thines M (2017b) New smut-specific primers for multilocus genotyping and phylogenetics of Ustilaginaceae. Mycological Progress 16: 1–9.View ArticleGoogle Scholar
  20. Liro JI (1924) Die Ustilagineen Finnlands. Annales Academiae Scientiarum Fennicae, series A 17(1): 1–636.Google Scholar
  21. Lutz M, Göker M, Piątek M, Kemler M, Begerow D, Oberwinkler F (2005) Anther smuts of Caryophyllaceae: molecular characters indicate host-dependent species delimitation. Mycological Progress 4: 225–238.View ArticleGoogle Scholar
  22. Malik CP, Thomas PT (1966) Karyotypic studies in some Lolium and Festuca species. Caryologia 19: 167–196.View ArticleGoogle Scholar
  23. McNeill J, Barrie FR, Buck WR, Demoulin V, Greuter W, et al. (2012) International Code of Nomenclature for algae, fungi, and plants (Melbourne Code) adopted by the Eighteenth International Botanical Congress Melbourne, Australia, July 2011. [Regnum Vegetabile No. 154.] Königstein: Koeltz Scientific Books.Google Scholar
  24. McTaggart AR, Shivas RG, Geering AD, Callaghan B, Vánky K. Scharaschkin T (2012a) Soral synapomorphies are significant for the systematics of the Ustilago-Sporisorium-Macalpinomyces complex (Ustilaginaceae). Persoonia 29: 63–77.View ArticleGoogle Scholar
  25. McTaggart AR, Shivas RG, Geering ADW, Vánky K, Scharaschkin T (2012b) A review of the Ustilago-Sporisorium-Macalpinomyces complex. Persoonia 29: 55–62.View ArticleGoogle Scholar
  26. McTaggart AR, Shivas RG, Geering ADW, Vánky K, Scharaschkin T (2012c) Taxonomic revision of Ustilago, Sporisorium and Macalpinomyces. Persoonia 29: 116–132.View ArticleGoogle Scholar
  27. McTaggart AR, Shivas RG, Boekhout T, Oberwinkler F, Vánky K, et al. (2016) Mycosarcoma (Ustilaginaceae), a resurrected generic name for corn smut (Ustilago maydis) and its close relatives with hypertrophied, tubular sori. IMAFungus 7: 309–315.View ArticleGoogle Scholar
  28. O’Donnell K (1993 Fusarium and its near relatives. In: The Fungal Holomorph: mitotic, meiotic and pleomorphic speciation in fungal systematics (Reynolds DR, Taylor JW, eds.): 225–233. Wallingford: CAB International.Google Scholar
  29. Piątek M, Lutz M, Chater AO (2013) Cryptic diversity in the Antherospora vaillantii complex on Muscari species. IMA Fungus 4: 5–19.View ArticleGoogle Scholar
  30. Ploch S, Telle S, Choi Y-J, Cunnington J, Priest M, et al. (2011) The molecular phylogeny of the white blister rust genus Pustula reveals a case of underestimated biodiversity with several undescribed species on ornamentals and crop plants. Fungal Biology 115: 214–219.View ArticleGoogle Scholar
  31. Ridgway KP, Duck JM, Young JPW (2003) Identification of roots from grass swards using PCR-RFLP and FFLP of the plastid trnL (UAA) intron. BMC Ecology 3(8): 1–6.Google Scholar
  32. Ronquist F, Huelsenbeck JP (2003) MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572–1574.View ArticleGoogle Scholar
  33. Savchenko, KG, Carris LM, Castlebury LA, Heluta VP, Wasser SP, Nevo E (2014a) Stripe smuts of grasses: one lineage or high levels of polyphyly? Persoonia 33: 169–181.View ArticleGoogle Scholar
  34. Savchenko KG, Carris LM, Castlebury LA, Heluta VP, Wasser SP, Nevo E (2014b) Revision of Entyloma (Entylomatales, Exobasidiomycetes) on Eryngium. Mycologia 106: 797–810.View ArticleGoogle Scholar
  35. Schneider J, Döring E, Hilu KW, Röser M (2009) Phylogenetic structure of the grass subfamily Pooideae based on comparison of plastid matK gene-3’trnK exon and nuclear ITS sequences. Taxon 58: 405–424.View ArticleGoogle Scholar
  36. Shenglian L, Wenli C, Phillips SM (2006) 87. Deyeuxia Clarion ex P. Beauvois, Ess. Agrostogr. 43. 1812. In: Flora of China (Zhengyi W, Raven PH, Deyuan H, eds) 22: 348–359. Beijing: Science Press.Google Scholar
  37. Spooner BM, Legon NW (2006) Additions and amendments to the list of British smut fungi. Mycologist 20: 90–96.View ArticleGoogle Scholar
  38. Stamatakis A (2014) RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30: 1312–1313.View ArticleGoogle Scholar
  39. Stevenson JA (1946) A nomenclatorial discussion of Ustilago striiformis. Plant Disease Reporter 30: 53–59.Google Scholar
  40. Stoll M, Begerow D, Oberwinkler F (2005) Molecular phylogeny of Ustilago, Sporisorium, and related taxa based on combined analyses of rDNA sequences. Mycological Research 109: 342–356.View ArticleGoogle Scholar
  41. Stoll M, Piepenbring M, Begerow D, Oberwinkler F (2003) Molecular phylogeny of Ustilago and Sporisorium species (Basidiomycota, Ustilaginales) based on internal transcribed spacer (ITS) sequences. Canadian Journal of Botany 81: 976–984.View ArticleGoogle Scholar
  42. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Molecular Biology and Evolution 30: 2725–2729.View ArticleGoogle Scholar
  43. Thines M (2016) Proposal to conserve the name Ustilago (Basidiomycota) with a conserved type. Taxon 65: 1170–1171.View ArticleGoogle Scholar
  44. Thines M, Choi Y-J, Kemen E, Ploch S, Holub EB, Shin H-D, Jones JDG (2009) A new species of Albugo parasitic to Arabidopsis thaliana reveals new evolutionary patterns in white blister rusts (Albuginaceae). Persoonia 22: 123–128.View ArticleGoogle Scholar
  45. Vánky K (2012) Smut Fungi of the World. St Paul, MN: American Phytopathological Society Press.Google Scholar
  46. Vánky K (2007) Taxonomic studies on Ustilaginomycetes - 27. Mycotaxon 99: 1–70.Google Scholar
  47. White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA sequences for phylogenetics. In: PCR Protocols: a guide to methods and applications (Innis N, Gelfand D, Sninsky J, White T, eds): 315–322. San Diego: Academic Press.Google Scholar

Copyright

© International Mycological Association 2018

Advertisement